The Korean Society For Biotechnology And Bioengineering
[ Research Paper ]
Korean Society for Biotechnology and Bioengineering Journal - Vol. 33, No. 1, pp.19-25
ISSN: 1225-7117 (Print) 2288-8268 (Online)
Print publication date 31 Mar 2018
Received 18 Dec 2017 Revised 27 Dec 2017 Accepted 27 Dec 2017
DOI: https://doi.org/10.7841/ksbbj.2018.33.1.19

나이아신 펩타이드 융합체의 피부 미백 소재로서의 기능성 평가

김가연1 ; 이승제1 ; 전미지1 ; 김보민1 ; 김근태1 ; 강상문2 ; 이기영2 ; 신은진2 ; 김상용3 ; 김영민1, *
1한남대학교 생명시스템과학과
2(주)에이앤펩
3신안산대학교 식품생명과학과
The Evaluation of Niacinamide-dipeptide Convergence as Skin Whitening Materials
Ga Yeon Kim1 ; Seung Je Lee1 ; Mi Ji Jeon1 ; Bo Min Kim1 ; Geun Tae Kim1 ; Sang Moon Kang2 ; Kee Young Lee2 ; Eun Jin Shin2 ; Sang Yong Kim3 ; Young Min Kim1, *
1Department of Biological Sciences and Biotechnology, College of Life Science and Nano Technology, Hannam University, Daejeon 34054 kym@hnu.kr
2A&pep Inc., Cheongju 28101
3Department of Food Science & Biotechnology, Shinansan University, Ansan 15435

Correspondence to: Department of Biological Sciences and Biotechnology, College of Life Science and Nano Technology, Hannam University, Daejeon 34054, Korea Tel: +82-42-629-8760, Fax: +82-42-629-8873 e-mail: kym@hnu.kr


© 2017 The Korean Society for Biotechnology and Bioengineering

Abstract

The purpose of this study was to investigate the skin-whitening effects of Niacinamide-dipeptide Convergence (Niacin-peptide). To evaluate skin-whitening effects of Niacin-peptide, we performed tyrosinase inhibition assay and L-DOPA oxidation inhibition assay. These results demonstrated that Niacin-peptide decreased melanin production through tyrosinase inhibition. Also, we measured expression level of melanogenesis-related mRNA and proteins by reverse transcription-polymerase chain reaction (PCR) and western blotting. Results of PCR and Western blotting were showed that Niacin-peptide reduced expression of microphthalmia-associated transcription factor (MITF), tyrosinase related protein-1 (TRP-1), tyrosinase related protein-2 (TRP-2) and tyrosinase. Thus, we identified the skin-whitening effect of Niacin-peptide and this finding demonstrated that Niacinamide-dipeptide Convergence may have potential as cosmetic ingredient.

Keywords:

niacin-dipeptide convergence, niacin-peptide, skin whitening, anti-melanogenic

1. INTRODUCTION

멜라닌은 멜라닌 세포 (Melanocyte) 내 멜라노좀 (Melanosome)에서 합성되는 검은 색소와 단백질의 복합체로, 인체의 피부에 존재한다 [1]. 멜라닌은 햇빛에 포함된 UV의 빛 에너지를 흡수해 피부 기관 보호 및 피부 노화를 억제하는 긍정적인 기능을 가지고 있는 반면, 과도하게 생성될 경우 피부에 색소 침착, 기미, 주근깨를 형성하기도 한다 [2,3]. 멜라닌 합성의 출발 물질은 아미노산의 일종인 티로신 (tyrosine)이며, 티로시나아제 (tyrosinase)와 tyrosinase related protein-1 (TRP-1), tyrosinase related protein-2 (TRP2, DCT)와 같은 효소들에 의해 생성된다 [4]. 티로신은 티로시나아제에 의해 가수분해 되어 도파 (DOPA), 도파 퀴논 (DOPA quinone)으로 전환되고, 도파 퀴논이 도파 크롬 (DOPA chrome)이 되어 최종적으로 붉은 계열의 eumelanin과 갈색 계열의 pheomelanin이 합성된다 [5]. 멜라노좀에서 합성된 멜라닌 색소는 멜라닌 세포의 수지상돌기를 통하여 인접세포인 각질세포로 이동된 후, 각 질세포를 통하여 피부 내 여러 부위에 분포한다 [6].

현재 사용되는 미백 소재들은 멜라닌 세포 (melanocyte)의 성장을 억제하거나 자극 조절 및 티로시나아제의 활성을 억제하여 멜라닌의 합성을 억제하는 효과를 가지고 있으며, 미백 기능을 갖는 대표적인 물질로는 resorcinol, hydroquinone, 4-hydroxyanisole, ascorbic acid, anisaldehyde, quercetin, arbutin이있다 [7]. 하지만 이러한 물질들은 피부 투과, 세포 독성 및 제형 내에서의 안전성 등과 같은 문제점들을 지니고 있다 [7,8]. 따라서 이러한 부작용으로부터 안전하고 효율적인 미백 및 항노화 소재를 탐색하기 위한 연구가 활발히 진행되고 있는 추세이다 [9].

펩타이드는 일반적으로 단백질의 기본 성분인 아미노산이 50개 이하로 결합되어 있으며, 단백질처럼 독특한 생물학적 활성을 보이는 생체 유래 물질이다 [10,11]. 과거에는 안전성의 문제로 사용에 제한이 따르던 펩타이드이지만 최근에는 여러 연구를 통하여 펩타이드가 주름 개선, 보습 증진, 탄력 증가를 일으키는 소재임이 밝혀졌다 [11,12].

따라서 본 연구에서는 펩타이드 합성을 위하여 필요한 보호기를 기존의 Fmoc, Boc 등의 보호기가 아닌 NSC 보호기를 활용하여 다양한 서열의 펩타이드 및 펩타이드 융합체를 생산하였고, 이를 이용하여 미백 화장품 소재로서의 이용 가능성을 확인하고자 하였다.


2. MATERIALS AND METHOD

2.1. 실험 재료 및 기기

실험에 사용된 3-(4,5)dimethyl-2 thiazolyl)-2,5-diphny-2H-tetra-zolium bromide (MTT), 3,4-Dihydroxy-L-phenylalamine (L-DOPA), tyrosinase from mushroom, L-tyrosine는 Sigma-Aldrich Co. (St. Louis, MO, USA)에서 구입하였으며 에탄올, 클로로폼, 이소프로판올 등의 시약은 시판 특급 시약을 사용하였다. 시료의 흡광도는 ELISA microplate reader (Model 680, Bio-Rad Laboratories, Inc., Tokyo, Japan)를 사용하여 측정하였다.

2.2. 펩타이드 융합체 제조

본 실험에 사용된 나이아신 디펩타이드 융합체는 A&pep (Chungbuk, Korea)에서 공급받아 사용하였다. N-peptide1 (311.29 Mol. wt., MALDI TOF, PerSeptive Biosystems, USA) 과 N-peptide2 (313.33 Mol. wt., MALDI TOF, PerSeptive Biosystems, USA)는 피부 미백 기능성 물질로 잘 알려진 나이아신아미드에 2종의 dipeptide를 각각 결합시킨 신규 융합 펩타이드이다.

2.3. 세포주 배양

본 실험에서 사용된 HaCaT (Human keratinocyte Cell line, Ha-CaT) 세포는 Dr. Fusenig (German Cancer Research Center, DKFZ, Heidelber, Germany)로부터 분양 받았으며, Mouse melanoma (B16F10) 세포는 American Type Culture Collection (ATCC, Rockville, MD, USA)에서 분양 받았다. 10% FBS와 1% antibiotics가 포함된 DMEM media (Hyclone, Laboratris Inc., Logan, UT, USA)를 사용하였으며, 5% CO2, 37oC incubator에서 배양하였다. 매 48시간마다 Trypsin-EDTA (Hyclone, Laboratories Inc., Logan, UT, USA)를 이용하여 세포를 부유 상태로 만든 다음 세포를 1×106 cells/mL로 분주하여 계대 배양하였다.

2.4. MTT assay

MTT assay 방법을 통하여 세포 생존율 및 세포 독성을 측정하였다. 12 well plate에 HaCaT 세포를 1×106 cells/mL로 분주한 다음 5% CO2, 37oC incubator에서 24시간 동안 배양하였다. 그 후, 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2를 농도별 (100, 500 μg/mL, 1 mg/mL)로 처리한 후 24시간 동안 5% CO2, 37oC incubator에서 배양하였다. 배양이 끝난 후 5 mg/mL 3-(4,5)dimethyl-2 thiazolyl)-2,5-diphny-2H-tetra-zoliumbromide (MTT, Sigma-Aldrich Co.) solution을 각 well 당 40 μL 처리한 후 30분 동안 CO2 incubator에서 반응시켰다. MTT solution이 포함된 media를 제거하고 PBS washing 후 각 well당 DMSO 150 μL을 첨가하여 생성된 formazan을 모두 녹인 다음 96 well plate에 100 μL씩 옮긴 후 ELISA microplate reader (Bio-Rad model 680, Bio-Red laboratories Inc., Tokyo, Japan)로 595 nm에서 흡광도를 측정하였다. 측정은 모두 3번 이상 하였으며, 이에 따른 평균값과 표준오차는 Microsoft Excel program을 사용하여 분석하였다.

2.5. Tyrosinase inhibition assay

나이아신 펩타이드 융합체의 미백 효능은 Tyrosinase inhibition assay 방법을 통하여 측정하였다. 시료로 사용된 N-peptide1과 N-peptide2은 100, 500 μg/mL, 1 mg/mL의 농도가 되도록 DW에 희석하여 사용하였다. 공시료는 PBS를 사용하였으며, 양성 대조군으로는 vitamin C (2 mg/mL)을 사용하였다. PBS 120 μL, 시료 10 μL, Tyrosinase (2 KU/mL) 10 μL, 1.5 mM Tyrosine 20 μL을 넣은 후 37oC에서 15분 동안 반응시켰다. 그 후 ELISA microplate reader (Bio-Rad model 680, Bio-Red laboratories Inc., Tokyo, Japan)로 490 nm에서 흡광도를 측정하였다. Tyrosinase 활성 저해율은 아래 식을 이용하여 계산하였다.

 %=100-b-b'a-a'×100
a : 공시료액의 반응 후의 흡광도
b : 시료액의 반응 후의 흡광도
a’, b’ : 타이로시나제 대신 완충액으로 대체하여 측정한 흡광도

2.6. DOPA oxidation inhibition assay

나이아신 펩타이드 융합체의 미백 효능은 DOPA oxidation inhibition assay 방법을 통하여 확인하였다. 시료로 사용된 나이아신 펩타이드 N-peptide1과 N-peptide2은 100, 500 μg/mL, 1 mg/mL의 농도가 되도록 DW에 희석하여 사용하였다. 공시료는 PBS를 사용하였으며, 양성 대조군으로는 vitamin C (1 mg/mL)를 사용하였다. PBS 1850 μL, 시료 50 μL, Tyrosinase (2 KU/mL) 50 μL을 넣은 후 37oC에서 6분 동안 반응시킨 후, 10 mM L-DOPA 50 μL 를 넣은 다음 37oC에서 1분 동안 반응시켰다. 그 후 ELISA microplate reader (Bio-Rad model 680, Bio-Red laboratories Inc., Tokyo, Japan)로 490 nm에서 흡광도를 측정하였고, DOPA 산화 활성 저해율은 아래 식을 이용하여 계산하였다.

DOPA 산화반응 저해율%=100-각시료액의 반응흡광도공시료액의 반응흡광도×100

2.7. Total RNA 추출 및 cDNA 합성

HaCaT 세포와 B16F10 세포를 각각 6 well plate에 1×106 cells/mL로 분주한 다음 5% CO2, 37oC incubator에서 24시간 동안 안정화시켰다. 그 후, N-peptide1과 N-peptide2의 최종농도가 500 μg/mL이 되도록 처리하여 24시간 동안 배양하였다. 배양 후 Media를 모두 제거한 뒤 PBS로 1회 Washing 하였다. 그 다음 RiboEX total RNA Isolation Solution (GeneAll Biotechnology, Seoul, Republic of Korea) 500 μL을 각 well에 처리하고 상온에서 5분 방치한 후 Scraper를 이용해 세포를 용해한 후 클로로폼, 이소프로판올, 70% 에탄올을 각각 첨가하는 과정을 통하여 total RNA를 추출하였다. 그 후의 cDNA 합성 과정은 DiaStarTM RT kit (SolGent, Seoul, Korea)를 이용하여 진행하였다. Total RNA 1 μL와 oligo(dT)20 primer 9 μL를 혼합한 뒤 65oC에서 5분 동안 반응시킨 후에 8 mM DTT 1 μL, Rnase (200 U/μL) 1 μL, 10 mM의 dNTP가 포함된 5X RT reaction buffer 4 μL, DEPC-DW를 첨가한 다음 40oC 에서 1시간, 95oC에서 5분 반응을 통하여 cDNA를 합성하였다.

2.8. 역전사 중합 효소 연쇄 반응 (Reverse Transcription Polymerase Chain Reaction, RT-PCR)

역전사 중합효소 연쇄반응은 DNA polymerase와 buffer, dNTP, tracking dye가 포함된 2X Taq PCR Smart mix 1 (SolGent, Seoul, Korea)를 이용하여 실시하였다. PCR 조건은 95oC에서 10분 동안 예비 가열 후, 95oC에서 30초 Denaturation, 각 specific primer sequences에 맞는 온도에서 30초 Annealing, 72oC에서 30초 Extension 과정을 35회 반복하였으며 72oC에서 10분 동안 안정화 과정을 진행하였다. TRP-1, TRP-2, MITF, Tyrosinase, GAPDH의 specific primer sequences는 Table 1과 같다.

primer sequence for the amplification of target gene

2.9. Western blot

6 well plate에 HaCaT 세포와 B16F10 세포를 각각 well 당 1×106 cells/mL로 분주하여 24시간 동안 안정화시킨 다음 N-peptide1과 N-peptide2를 각각 최종농도가 500 μg/mL이 되도록 처리하여 5% CO2, 37oC incubator에서 24시간 동안 배양하였다. 그 다음 RIPA lysis buffer [25 mM Tris-Cl (pH 7.4), 1% NP 40, 0.5% sodium deoxycholate, 150 mM NaCl, 1 mM PMSF]를 각 well에 150 μL씩 첨가하여 단백질을 분리한 뒤 14,000 rpm, 4oC에서 20분 동안 원심분리하여 상등액을 취하였다. 분리한 단백질은 ELISA-reader를 이용하여 595 nm에서 흡광도 측정 후 정량한 다음 8%, 12% Acrylamide gel을 이용하여 전기영동을 실시하였다. 그 다음 nitro cellulose membrane에 transfer하고 2% Bovine serum albumin (BSA)를 이용하여 blocking한 후, 1차 항체를 4oC에서 밤새 반응시키고 2차 항체를 결합시킨 다음 실험 결과를 측정하였다.

2.10. 통계 처리

통계 프로그램인 SPSS 22.0을 사용하였고 실험 설계에 대한 분산 분석은 일원배치 분산분석 (one-way ANOVA)과 독립표본 t-test (independent sample t-test)를 실시하여 검정하였다. 각 자료는 3번 이상의 반복된 실험을 통하여 얻어진 결과로 검정하였고 p<0.05인 경우 통계적으로 유의한 것으로 판정하였다.


3. RESULTS AND DISCUSSION

3.1. 나이아신 펩타이드 융합체의 Tyrosinase 저해 활성

미백 효능의 효력 시험으로 Tyrosinase inhibition assay와 DOPA oxidation inhibition assay가 많이 사용되고 있으며, 이 두 시험법은 멜라닌 생성 과정에 참여하는 티로시나아제 저해 활성을 측정한다 [13]. 멜라닌은 멜라노좀에서 생성되는 색소로서 티로시나아제에 의해 합성되며, 티로시나아제는 인체 내 멜라닌 생합성 경로에서 초기 속도 결정 단계에 관여하는 효소이다 [13,14]. 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2의 티로시나아제 저해 활성을 측정 결과, Fig. 1에 나타난 바와 같이 N-peptide1의 경우 100 μg/mL의 농도에서 10%, 500 μg/mL의 농도에서 14.44%, 1 mg/mL의 농도에서 17.22%의 티로시나아제 억제 효능이 관찰되었다. 또한 N-peptide2의 경우 100 μg/mL의 농도에서 9.44%, 500 μg/mL의 농도에서 12.78%, 1 mg/mL의 농도에서 15%의 티로시나아제 억제 효능이 관찰되었다 (Fig. 1). 이는 양성 대조군인 Vitamin C 보다 낮은 억제 효과를 보이지만 Vitamin C 대비 50% 이상의 비율을 차지함으로써 비교적 높은 티로시나아제 활성 억제 효과를 지닌 것으로 볼 수 있다.

Fig. 1.

Tyrosinase activitiy inhibition effect of Niacin-peptide. (a) and (b) are inhibitory effects of Niacin-peptide against tyrosinase activity. Results are from three experiments and are expressed as mean±SD (n=3).

3.2. 나이아신 펩타이드 융합체의 L-DOPA oxidation 저해활성

DOPA는 멜라닌 생합성 경로 중 티로시나아제에 의해 도파 퀴논, 도파 크롬으로 전환되고 최종적으로 멜라닌이 된다 [14]. DOPA oxidation inhibition assay는 티로시나아제의 작용에 의한 도파 크롬의 생성을 흡광도로 측정하여 미백 성분의 효과를 평가하는 시험법이다 [15,16]. 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2의 DOPA oxidation 저해 효능을 측정한 결과, N-peptide1의 경우 100 μg/mL의 농도에서 9.5%, 500 μg/mL의 농도에서 12.3%, 1 mg/mL의 농도에서 23.6%의 DOPA oxidation 저해 효능이 관찰되었다(Fig. 2). N-peptide2의 경우, 100 μg/mL의 농도에서 19.7%, 500 μg/mL의 농도에서 27.7%, 1 mg/mL의 농도에서 29%의 DOPA oxidation 저해 효능을 보였다. 티로시나아제 억제 효능과 마찬가지로 양성 대조군인 Vitamin C 보다는 낮은 억제 효과를 보이지만 Vitamin C 대비 50% 이상의 DOPA oxidation 저해 효능을 나타내었다. 따라서 본 실험을 통하여 N-peptide1과 N-peptide2의 미백 효능을 확인하였다.

Fig. 2.

L-DOPA oxidation activity inhibition effect of Niacin-peptide. (a) and (b) are inhibitory effects of Niacin-peptide against L-DOPA oxidation activity. Results are from three experiments and are expressed as mean±SD (n=3).

3.3. 나이아신 펩타이드 융합체의 세포 독성 검사

피부 표피층을 구성하는 피부 각질 형성 세포 HaCaT은 피부 미백, 피부 재생 등과 관련된 많은 실험에서 널리 사용되고 있는 세포주이다 [17]. 본 연구에서는 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2이 화장품 원료로써 피부를 구성하는 피부 세포에 대한 독성 여부를 확인하기 위해 MTT assay를 실시하였다. 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2을 각각 24시간 동안 처리한 후에 세포 생존율을 측정한 결과, Fig. 3에 나타난 바와 같이, HaCaT 세포에서 N-peptide1과 N-peptide2에 의한 세포 생존률이 90% 이상으로 세포 독성이 나타나지 않음을 확인하였다.

Fig. 3.

Cytotoxic Effects of Niacin-peptide in HaCaT cells. Cell viability was measured by MTT assay. Cells were treated with Niacinpeptide for 24 h. The statistical analysis of the data was carried out by using a t-test. N. S. is not significant (each experiment, n=3).

3.4. 나이아신 펩타이드 융합체의 미백 관련 유전자 발현 저해 효과

인체 내에서 멜라닌 생성은 주로 산화적 반응이 원인이 되며, 이와 관련된 효소에는 티로시나아제, tyrosinase related protein-1 (TRP-1), tyrosinase related protein-2 (TRP-2) 등이 있다 [17]. 티로시나아제는 type 1 membrane glycoprotein으로서 N-linked glycosylation 과정에 의해 생성되고 멜라노좀 내에 있는 티로신을 산화시켜 3,4-dihydroxyphenylalanine (DOPA)를 만드는 티로신 수산화 효소 (Tyrosine hydroxylase)로 작용한다 [17]. 선행 연구에 의하면 멜라닌 세포 내 티로시나아제 유전자 발현이 증가하게 되면 멜라닌 합성이 증가한다고 보고되었다 [17-19]. TRP-1는 TRP-2에 의해 생성된 5,6-dihydroxyindole-2-carboxylic acid (DHICA)를 산화시켜 indole2-carboxylic acid (IQCA)로 전환시켜 멜라닌 합성에 관여하며, 이들은 멜라닌 생성 및 분해 촉진 단계에서의 역할이 중요시되고 있어 미백 효과 검증에 많이 연구되고 있다 [19,20]. 또한 MITF는 microphthalamia transcription factor로서 티로시나아제 및 TRPs의 M-box sequences에 결합하여 티로시나아제, TRP-1, TRP-2의 전사를 촉진한다 [20,21]. 따라서 본 연구에서는 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2가 멜라닌 합성에 관여하는 주요 효소들 티로시나아제, TRP1, TRP2, MITF의 유전자 및 단백질 발현에 미치는 영향을 확인하고자 하였다. 그 결과, Fig. 4(a)와 같이 B16F10 세포에 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2를 500 μg/mL의 농도로 처리했을 때 멜라닌 합성 관련 효소 티로시나아제, TRP-1, TRP-2, MITF의 유전자 발현이 감소하였다. Fig. 4(b)에 나타난 바와 같이 MITF, TRP-1, TRP-2의 단백질 발현 역시 감소하며 양성 대조군인 vitamin C와 비교했을 때, 단백질 발현 정도가 vitamin C와 유사한 결과를 나타내었고, 이를 통해 N-peptide1과 N-peptide2의 멜라닌 합성 관련 효소들에 대한 우수한 억제 효과를 확인하였다. 결과적으로 본 실험을 통하여 N-peptide1과 N-peptide2이 티로시나아제, TRP-1, TRP-2 및 MITF와 같은 멜라닌 합성 관련 유전자의 발현을 조절함으로써 나타나는 미백 효과를 확인하였다.

Fig. 4.

Regulation of Niacin-peptide on melanogenesis-related gene and protein expression level in B16F10 cells. Cells were treated with Delivery (D.W), Vitamin C, N-peptide1 and N-peptide2 500 μg/mL for 24 h. (a) The gene expression of TRP-1, -2, MITF, Tyrosinase were analyzed by PCR and (b) Western blot analysis. The GADPH and β-actin were used as a loading control.


4. CONCLUSION

본 연구에서는 티로시나아제 저해 활성 및 L-DOPA oxidation 저해 활성 측정, 멜라닌 생합성 경로관련 유전자와 단백질 발현을 in vitro 실험을 통하여 나이아신 펩타이드 융합체 N-peptide1과 N-peptide2의 미백 소재로서 응용 가능성을 알아보았다. Tyrosinase inhibition assay와 DOPA oxidation inhibition assay를 통해 N-peptide1과 N-peptide2의 티로시나아제 저해 활성 및 DOPA oxidation 저해 활성을 측정한 결과, N-peptide1과 N-peptide2 모두 양성 대조군 vitamin C 대비 50% 이상의 저해 효과를 보여주었고, 농도 의존적으로 티로시나아제 및 DOPA oxidation 활성을 저해하였다. 또한 MTT assay를 통하여 N-peptide1과 N-peptide2의 피부 세포에 대한 세포독성 검사를 실시한 결과, N-peptide1 및 N-peptide2 처리에 따른 세포 독성이 나타나지 않았다. N-peptide1과 N-peptide2 처리에 따른 멜라닌 생합성 경로에 참여하는 효소들의 단백질 및 유전자 발현을 확인한 결과, 티로시나아제, TRP-1, TRP-2 및 MITF와 같은 멜라닌 생합성 관련 효소들의 유전자 발현과 단백질 발현이 억제되었고, 양성 대조군 vitamin C와 유사한 억제 효과를 나타내었다. 따라서, N-peptide1과 N-peptide2이 피부 세포에 독성을 나타내지 않고 인체 내 멜라닌 합성 경로에 관여하는 효소들의 유전자 및 단백질 발현 억제 효과를 지닌 것을 보아 미백 효능을 지닌 기능성 화장품 소재로서 가능성이 기대된다.

Acknowledgments

본 연구는 2016년도 중기청 융복합사업 (과제번호 S2356755)에 의해 수행되었음.

References

  • Jin, Y. Z., Y. A. Ahn, E. S. Hong, G. H. Li, E. K. Kim, and K. H. Row, (2005), Extraction of whitening agents from natural plants and whitening effect, J. Kor. Ind. Eng. Chem, 16, p348-353.
  • Song, H. Y., N. Y. Sung, P. M. Jung, M. S. Kang, W. J. Park, and E. H. Byun, (2015), Whitening effect of green tea seed shell ethanol extracdts, J. Kor. Soc. Food. Sci. Nutr, 44, p1470-1477, [https://doi.org/10.3746/jkfn.2015.44.10.1470] .
  • Jung, H. K., J. H. Jang, J. H. Ko, B. M. Kang, J. H. Yeo, J. H. Cho, H. W. Cho, C. G. Bean, S. C. Kim, and W. S. Jung, (2014), Whitening and anti-wrinkle effects of Korean native Dendrobium moniliforme methanol extract, J. Kor. Medicinal Crop. Sci, 22, p331-338, [https://doi.org/10.7783/kjmcs.2014.22.5.331] .
  • Mo, J. H., and S. J. Oh, (2013), Tyrosinase inhibitory activity and melanin production inhibitory activity of the methanol extract and fractions from Dendropanax morbifera Lev, J. Kor. Asethet. Cosmetol, 11, p275-280.
  • Jung, S. H., M. J. Gu, H. J. Moon, B. C. Yu, M. J. Jeon, and Y. H. Lee, (2009), Inhibitory effects of fucoidan on melanin synthesis and tyrosinase activity, J. Life Sci, 19, p75-80.
  • Han, J. S, and D. H. Yi, (2012), Effects of pine needles fermentation on antioxidant activity and inhibition of melanin synthesis, Kor. J. Aesthet. Cosmetol, 10, p619-624.
  • Chang, M. S., H. M. Kim, W. M. Yang, D. R. Kim, E. H. Park, E. B. Ko, M. J. Choi, H. Y. Kim, J. H. Oh, K. J. Shim, J. W. Yoon, and S. K. Park, (2007), Inhibitory effects of Nelumbo nucifera on tyrosinase activity and melanogenesis in clone M-3 melanocyte cells, Kor. J. Herbol, 22, p87-94.
  • Chang, C. T., W. L. Chang, J. C. Hsu, Y. Shih, and S. T. Chou, (2013), Chemical composition and tyrosinase inhibitory activity of Cinnamomum cassia essential oil, Chang. et al. Bota. Stud, 54, p10-17, [https://doi.org/10.1186/1999-3110-54-10] .
  • Park, J. M., and K. J. Kim, (2010), The anti-wrinkle effects and whitening effects of Galla Rhois, J. Kor. Ori. Med. Opht. Otol, 23, p135-148.
  • Cho, Y. H., J. H. Kim, D. H. Lee, B. C. Lee, and H. B. Pyo, (2005), Effect of etyl acetate fraction from melothria heterophylla on antioxidant activity and metrix metalloproteinase-1 expression in ultraviolet-A irradiated human dermal fibroblast, J. Soc. Cosmet. Sci. Kor, 31, p103-109.
  • Moh, S. H., D. H. Jung, H. S. Kim, M. J. Cho, H. H. Seo, and S. J. Kim, (2011), Characteristics and applications of bioactive peptides in skin care, Kor. Soc. Biotechnol. Bioeng. Jor, 25, p483-490.
  • Kim, J. K., J. H. Lee, I. H. Bae, D. B. Seo, and S. J. Lee, (2011), Beneficial effect of a collagen peptide supplement on the epidermal skin barrier, Kor. J. Food Sci. Technol, 43, p458-463, [https://doi.org/10.9721/kjfst.2011.43.4.458] .
  • Choung, M. G., Y. S. Hwang, G. P. Kim, K. G. Ahn, H. S. Shim, S. B. Hong, J. H. Choi, C. Y. Yu, I. M. Chung, S. H. Kim, and J. D. Lim, (2013), Antimelanogenic effect and whitening of antocyanin rich fraction from seeds of Liriope platyphylla, J. Kor. Medicinal Crop. Sci, 21, p361-371, [https://doi.org/10.7783/kjmcs.2013.21.5.361] .
  • Oh, M. C., K. C. Kim, C. I. Ko, Y. S. Ahn, and J. W. Hyun, (2015), Peptides-derived from scales of Branchiostegus japonicas inhibit ultraviolet B-induced oxidative damage and photo-aging in skin cells, J. Life Sci, 25, p269-275, [https://doi.org/10.5352/jls.2015.25.3.269] .
  • Hwang, J. G., J. K. Yun, K. H. Han, E. J. Do, J. S. Lee, E. J. Lee, J. B. Kim, and M. R. Kim, (2011), Anti-oxidation and anti-aging effect of mixed extract from Korean medicinal herbs, J. Kor. Herbol, 26, p111-117.
  • Nam, B. H., W. S. Jo, W. J. Choi, J. Y. Lee, E. Y. Kang, M. H. Jeong, and J. D. Lee, (2010), Inhibitory effects of melanin secretion on B16 melanoma cell of Cordyceps militaris water extract, Kor. J. Mycol, 38, p167-171, [https://doi.org/10.4489/kjm.2010.38.2.167] .
  • Park, S. A., J. Park, C. I. Park, Y. J. Jie, Y. C. Hwang, Y. H. Kim, S. H. Jeon, H. M. Lee, J. H. Ha, K. J. Kim, and S. N. Park, (2013), Cellular antioxidant activity and whitening effects of Dendropanax morbifera leaf extracts, Kor. J. Micro. Biotechnol, 41, p407-415, [https://doi.org/10.4014/kjmb.1311.11001] .
  • Park, Y. H., J. H. Kim, J. H. Choi, and S. Y. Park, (2009), Effects of eriobotryae folium as anti-oxidant on HaCaT keratinocyte, J. Kor. Orie. Med. Opht. Otol. Derm, 22, p20-35.
  • You, J. K., M. J. Chung, D. J. Kim, D. J. Seo, J. H. Park, T. W. Kim, and M. Choe, (2009), Antioxidant and tyrosinase inhibitory effects of Paeonia suffruticosa water extract, J. Kor. Soc. Food. Sci. Nutr, 38, p292-296, [https://doi.org/10.3746/jkfn.2009.38.3.292] .
  • Branza-Nichita, N., G. Negroiu, A. J. Petrescu, E. F. Garman, F. M. Platt, M. R. Wormald, R. A. Dwek, and S. M. Petrescu, (2000), Mutations at critical N-glycosylation sites reduce tyrosinase activity by altering folding and quality control. Jor, Bio. Chem, 275, p8169-8175.
  • Yoon, H. J., J. W. Shin, Y. K. Kim, J. E. Kim, and K. H. Cho, (2007), The effect of vitamin C and E on the expression of the cutaneous basement membrane components, Kor. J. Inve. Der, 14, p87-98.

Fig. 1.

Fig. 1.
Tyrosinase activitiy inhibition effect of Niacin-peptide. (a) and (b) are inhibitory effects of Niacin-peptide against tyrosinase activity. Results are from three experiments and are expressed as mean±SD (n=3).

Fig. 2.

Fig. 2.
L-DOPA oxidation activity inhibition effect of Niacin-peptide. (a) and (b) are inhibitory effects of Niacin-peptide against L-DOPA oxidation activity. Results are from three experiments and are expressed as mean±SD (n=3).

Fig. 3.

Fig. 3.
Cytotoxic Effects of Niacin-peptide in HaCaT cells. Cell viability was measured by MTT assay. Cells were treated with Niacinpeptide for 24 h. The statistical analysis of the data was carried out by using a t-test. N. S. is not significant (each experiment, n=3).

Fig. 4.

Fig. 4.
Regulation of Niacin-peptide on melanogenesis-related gene and protein expression level in B16F10 cells. Cells were treated with Delivery (D.W), Vitamin C, N-peptide1 and N-peptide2 500 μg/mL for 24 h. (a) The gene expression of TRP-1, -2, MITF, Tyrosinase were analyzed by PCR and (b) Western blot analysis. The GADPH and β-actin were used as a loading control.

Table 1.

primer sequence for the amplification of target gene

Gene Primer sequence (5'-3') Amplification size (bp) Annealing temperature (oC)
TRP-1 For: GCTCCAGACAACCTGGGATA 234 59.0
Rev: TCAGTGAGGAGAGGCTGGTT
TRP-2 For: GATGGACCAGGCAGTAAGGA 159 61.0
Rev: GCCTCACCCATCAATCTGTT
MITF For: CAACTCATGCGTGAGCAGAT 203 60.5
Rev: TACTTGGTGGGGTTTTCGAG
Tyrosinase For: TACGGCGTAATCCTGGAAAC 203 60.0
Rev: ATTGTGCATGCTGCTTTGAG
GAPDH For: GGACTTCGAGCAAGAGATGG 234 60.0
Rev: AGCACTGTGTTGGCGTACAG