The Korean Society For Biotechnology And Bioengineering

Current Issues

Korean Society for Biotechnology and Bioengineering Journal - Vol. 34 , No. 2

[ Research Paper ]
Korean Society for Biotechnology and Bioengineering Journal - Vol. 34, No. 2, pp.80-84
Abbreviation: KSBB J
ISSN: 1225-7117 (Print) 2288-8268 (Online)
Print publication date 30 Jun 2019
Received 31 Jan 2019 Revised 21 Mar 2019 Accepted 14 Apr 2019
DOI: https://doi.org/10.7841/ksbbj.2019.34.2.80

문화재로부터 선별된 미생물의 동정 및 바이오매스 분해 활성 확인
박동민1 ; 김샛별1 ; 권덕호1 ; 박재범1 ; 소명기2 ; 이병훈3 ; 홍억기1 ; 하석진1, *
1강원대학교 생물공학과
2강원대학교 재료공학과
3(재)강원문화재연구소

Identification of Microorganisms Isolated from Ancient Cultural Heritage and Verification of Biomass Degrading Activities
Dong-Min Park1 ; Saet-Byeol Kim1 ; Deok-Ho Kwon1 ; Jae-Bum Park1 ; Myoung-Gi So2 ; Byeong Hoon Lee3 ; Eock-Kee Hong1 ; Suk-Jin Ha1, *
1Department of Bioengineering and Technology, Kangwon National University, Chuncheon 24341, Korea, Tel: +82-33-250-6278, Fax: +82-33-243-6350 (sjha@kangwon.ac.kr)
2Department of Materials Science and Engineering, Kangwon National University, Chuncheon 24341, Korea
3Kangwon Research Institute of Cultural Heritage, Chuncheon 24227, Korea
Correspondence to : *Department of Bioengineering and Technology, Kangwon National University, Chuncheon 24341, Korea Tel: +82-33-250-6278, Fax: +82-33-243-6350, E-mail: sjha@kangwon.ac.kr


© 2019 The Korean Society for Biotechnology and Bioengineering
Funding Information ▼

Abstract

Ancient cultural heritage is very important in historical worth which they must be preserved in. However, they are rotten and disintegrated easily by various microorganisms like fungi and bacteria because they are mostly made up of wood and paper. In order to control these microbes, we need to investigate these microbes to maintain historical worth of ancient cultural heritage. We collected several samples from surface of ancient documents and wooden artifacts. And then microorganisms were isolated from the samples and identified through sequencing of 16S ribosomal RNA or internal transcribed spacer region. As results of sequencing, two bacterial strains (E-1, O-1) were identified as Staphylococcus hominis and S. epidermidis and four fungal strains (A-1, M-1, M-2, K-1) were identified as Schizophyllum commune, Peniophora incarnata, Cephalotheca foveolata, Aspergillus niger. Among them, A-1 strain showed relatively higher cellulose and CMC degrading activities and K-1 strain showed relatively higher xylan degrading activity than other strains.


Keywords: ancient cultural heritage, microorganisms, cellulose, hemicellulose

1. INTRODUCTION

실외에 존재하는 목조건축물의 손상은 다양한 원인에 의해 야기되며, 특히 목재의 특성으로 인해 곤충 또는 곰팡이가 그 주요 손상 원인이 된다. 그 중에서도 흰개미와 목재부후균에 의한 피해는 목조건축물의 외형을 손상시키며 목조건축물의 강도를 저하시켜 전체 구조의 변형을 일으키는 원인 중 하나로 알려져 있다 [1]. 곰팡이 등의 미생물의 성장으로 인한 피해는 고분 등에서도 나타나고 있으며 이러한 피해는 우리나라뿐만 아니라 일본과 프랑스에서도 발생하였다. 특히 프랑스에서는 2001년부터 시작된 라스코 고분 (Lascaux Cave) 벽화의 곰팡이 발생을 억제하기 위해 살생물제 (biocide)를 처리하여 곰팡이의 성장을 억제하려는 새로운 시도를 하고 있다 [2]. 고분과 같은 갇혀있는 공간에서의 미생물 번식은 조절과 억제가 매우 어려우며 이에 대한 대책 마련이 필요하다. 박물관에 전시되어 있는 고대 문화재의 경우엔 특히 서책 또는 목재 유물에 곰팡이의 발생은 습도와 온도, 영양분 및 환경 등에 영향을 받으며, 이러한 조건이 충족될 때 곰팡이의 성장이 이루어진다 [3]. 따라서 고대 문화재를 전시하는 박물관은 공기에 존재하는 먼지 또는 곰팡이로 인해 피해를 받으며 이러한 미생물의 번식은 고대 문화재의 손상을 초래한다.

국내 문화재의 적절한 보존 또는 관리 계획을 확립하기 위해서는 먼저 문화재 주변의 생물 분포와 보존 환경에 대한 면밀한 조사가 필요하다. 수계에 인접한 여주 신륵사 목조건축물의 생물 분포를 모니터링 하나, 공주 송산리 고분의 미생물 분포를 확인하고 동정하거나, 강진 무위사 성보 박물관 전시실의 미생물 분포를 확인한 연구 연구결과들이 이미 보고되었다 [4-6]. 이러한 문화재에서 확인된 미생물 중에는 곰팡이류가 많은 비중을 차지하고 있으며 이들은 목재 또는 서적류 등의 바이오매스를 분해하기 위한 cellulase 또는 hemicellulase 등의 효소를 생합성하는 능력이 있는 것으로 알려져 있다. 곰팡이류로부터 생산이 가능한 cellulase 또는 hemicellulase 효소는 바이오매스를 분해하여 바이오연료, 바이오플라스틱 또는 기능성 고부가가치 물질을 생산하기 위한 목적으로 연구가 이루어지고 있다 [7-9].

따라서 본 연구에서는 강원도의 박물관에 보관되어 있는 고문서 또는 목재 문화재로부터 미생물을 수집하고 동정하였으며 이들로부터 바이오매스 분해효소의 활성을 비교하고 그 특징을 파악하고자 한다.


2. MATERIALS AND METHODS
2.1. 고대 문화재로부터 미생물 선별

16 종류의 서적류 및 목재 유물의 표면으로부터 멸균된 면봉을 이용하여 각각의 시료를 얻었다. 얻어낸 시료는 멸균수 3 mL을 첨가하고 충분히 섞어준 후 1시간동안 냉장보관 하였다. 1시간 후 10배 그리고 100배로 연속 희석한 후 각각의 원액과 희석물들을 YM 한천배지 (yeast extract 30 g/L, malt extract 30 g/L, peptone 50 g/L, agar 15 g/L) 또는 LB 한천배지 (yeast extract 5 g/L, tryptone 10 g/L, sodium chloride 10 g/L, agar 15 g/L)에 도말하여 접종하였다. 접종된 한천배지들은 30℃에서 2주간 배양하였으며 미생물의 성장속도에 따라서 각각의 단일종 곰팡이류와 세균류로 분리하였다. 분리된 균주들은 실험에 사용되기 전까지 30% glycerol stock 형태로 −70℃에 보관하였다.

2.2. 선별된 미생물의 genomic DNA 추출 및 균주 동정

선별된 곰팡이류는 YM 한천배지를 이용하여 25℃에서 배 양하였으며 세균류는 LB 액체배지를 이용하여 온도 37℃ 그리고 200 rpm조건으로 교반하며 배양하였다. 각각의 곰팡이류와 세균류는 배양 후 i-genomic BYF DNA Extraction Mini Kit (한국, iNtRON Biotechnology)를 이용하여 genomic DNA 를 추출하였다. 추출된 genomic DNA로부터16S ribosomal RNA (16S rRNA) region 또는 internal transcribed spacer (ITS) region을 각각 Premix TaqTM (Takara, 일본)을 이용하여 증폭하였다. 이때 사용된 primer들은 Table 1에 기술하였다. 증폭된 DNA는 TOPclonerTM TA core Kit (Enzynomics, 한국)를 이용하여 E. coli TOP10 균주에 삽입한 후, DNA-spin Plasmid DNA Purification Kit (iNtRON Biotechnology, 한국)를 통하여 T-vector 정제하였다. 정제된 T-vector에 삽입된 DNA의 염기서열은 new generation sequencing (NGS) 분석 방법을 통하여 확인하였으며 (Macrogen, 한국) 분석된 DNA의 염기서열은 national center for biotechnology information (NCBI)의 Megablast를 이용하여 분석하였다.

Table 1. 
Primers used for identification of isolated microorganisms in this study.
Primer name Sequence (5'→3') region
27F AGAGTTTGATCMTGGCTCAG 16S rRNA
1492R CGGTTACCTTGTTACGACTT
ITS1 TCCGTAGGTGAACCTGCGG ITS
ITS4 TCCTCCGCTTATTGATATGC
785F GGATTAGATACCCTGGTA 16S rRNA
907R CCGTCAATTCMTTTRAGTTT

2.3. Solid state fermentation을 통한 효소 추출물 생산

Cellulose (미국, SIGMA-ALDRICH, C6288) 5 g이 첨가된 YM배지 7 mL에 PDA 한천배지 (potato starch 4 g/L, dextrose 20 g/L, agar 15 g/L)에서 성숙한 곰팡이류의 포자를 접종하여 28℃에서 5일간 배양하였다. 배양이 끝난 후 pH 5.0의 50 mM citrate buffer를 20 mL 첨가하여 30분 동안 온도 4℃ 그리고 120 rpm의 조건으로 교반하며 추출하였다. 이 후 원심분리기 (한일과학산업㈜, combi 514R, 한국)를 이용하여 15분간 9000 g로 원심분리하여 상등액을 분리한 후 NML syringe filter 0.2 μm (Satorius, 독일)를 이용하여 상등액의 남은 부유물들을 제거한 후 4℃에서 냉장 보관하였다.

2.4. Cellulose, CMC 또는 xylan 분해 활성 측정

각 곰팡이류의 효소 추출물에 cellulose (SIGMA-ALDRICH, C6288, 미국), carboxymethyl cellulose (CMC, SIGMAALDRICH, 21902, 미국) 또는 xylan (TCI, X0078, 일본)을 각각 2%의 농도로 첨가하여 citrate buffer (50 mM, pH 5.0) 그리고 40℃ 조건에서 24시간 동안 반응시켰다. 시료를 취한 후 끓는 물에서 10분간 가열하여 효소를 불활성화 시켰다. 이후 high performance liquid chromatography (HPLC) 분석을 수행하여 cellulose, CMC 또는 xylan의 분해에 따른 glucose 및 xylose의 생성 농도를 확인하였다. HPLC의 분석과정에서 용매의 유속은 0.6 mL/min, 컬럼 온도는 50℃이었으며 용매는 5 mM 황산 용액이 사용되었다. HPLC는 미국 Agilent technologies사의 1260 series가 사용되었으며 분석컬럼은 RezexTM ROA-Organic Acid H+ (8%) column (150 × 7.8 mm, 미국, Phenomenex, 00F-0138-K0)가 사용되었다. 각 곰팡이 류의 바이오매스 분해효소 활성을 비교하기 위해 기존에 연구결과가 보고된 Aspergillus niger KCTC6461과 Trichoderma reesei KCTC6968의 결과와 각각 비교 분석하였다 [10,11]. A. niger KCTC6461과 T. reesei KCTC6968는 생물자원센터 (Korean collection for type cultures, KCTC)로부터 제공받았다.


3. RESULTS AND DISCUSSION
3.1. 고대 문화재에 서식하는 미생물 선별

박물관에 보관되어 있는 16종의 서적류 및 목재 유물의 표면으로부터 멸균된 면봉을 이용하여 미생물이 서식할 것으로 예상되는 부분의 시료를 각각 취하였다. 수집된 16종의 시료들은 다음과 같다. 수장고-1 서적류의 시료 2종 (A, B), 수장고-1 문서류의 시료 3종 (C, D, E), 수장고-2 서적류의 시료 2종 (F, G), 수장고-2 문서류의 시료 3종 (H, I, J), 수장고-1의 지류 3종 (K, L, M), 수장고-2의 지류 1종 (N), 전시유물 목재 1종 (O), 수장고 목재 1종(P). 각각의 시료를 멸균수를 이용하여 충분히 현탁한 후에 현탁액 원액, 10배 희석액, 또는 100배 희석액을 YM 한천배지 또는 LB 한천배지에 도말하여 접종한 후 30℃ 조건에서 2주간 배양하여 각각의 단일종 곰팡이류와 세균류로 분리하였다.

가장 먼저 배양 3일 후에 시료E (수장고-1 문서류)를 접종한 LB 한천배지로부터 한 종류의 세균류가 발견되었다. 그 이후 배양 5일 후에 시료A (수장고-1 서적류)를 접종한 YM 한천배지로부터 한 종류의 곰팡이류가, 시료K (수장고-1의 지류)를 접종한 YM 한천배지로부터 한 종류의 곰팡이류가, 시료M (수장고-1의 지류)을 접종한 YM 한천배지로부터 한 종류의 곰팡이류가 그리고 시료O (전시유물 목재)를 접종한 YM 한천배지로부터 한 종류의 세균류가 각각 발견되었다. 13일 후엔 시료M (수장고-1의 지류)을 접종한 LB 한천배지로부터 한 종류의 곰팡이류가 발견되었다. 최종적으로 6종의 시료로부터 2종류의 세균류와 4종류의 곰팡이류를 선별 하였으며 선별된 시료의 위치를 이용하여 각각 각각 E-1, O-1 (세균류) 그리고 A-1, M-1, M-2, K-1 (곰팡이류)로 명명하였다.

3.2. 선별된 세균류와 곰팡이류의 동정 결과

고대 문화재로부터 선별된 세균류와 곰팡이류들을 동정하기 위해 각각의 미생물들의 genomic DNA를 추출한 한 후에 internal transcribed spacer (ITS) region와 16S ribosomal RNA (16S rRNA) region을 각각 PCR을 이용하여 DNA 증폭을 수행하였다. 각각의 증폭된 DNA의 염기서열을 분석한 후 NCBI의 Megablast 방법을 이용하여 6종 균주의 동정을 시도하였다 (Table 2).

Table 2. 
Identification results of two bacterial and four fungal strains isolated from ancient cultural heritage
Name Organism Query cover Accession numbera
E-1 Staphylococcus hominis strain FDAARGOS_136 95% CP014107.1
Staphylococcus hominis isolate OTU-c64 95% KJ147074.1
Staphylococcus hominis J6 95% LT963442.1
O-1 Staphylococcus epidermidis strain GTH12 97% CP028282.1
Staphylococcus epidermidis strain FDAARGOS_153 97% CP014119.1
Staphylococcus epidermidis strain DAR1907 97% CP013943.1
A-1 Schizophyllum commune voucher A.S-E 100% MH307932.1
Schizophyllum commune strain FPYF3010 1 100% KU845337.1
Schizophyllum commune strain WB033_12 100% JX848644.1
K-1 Aspergillus niger strain ANSTJ01 100% KY825168.1
Aspergillus niger strain ISSFR-019 100% KY825168.1
Aspergillus niger strain ISSFR-001 100% KT832780.1
M-1 Peniophora incarnata strain xsd08030 100% EU918698.1
Peniophora incarnata isolate: C212 96% LC168790.1
Peniophora incarnata isolate CF30 97% KM979732.1
M-2 Cephalotheca foveolata isolate UTHSCSA DI 14-21 100% KJ573100.1
Cephalotheca foveolata strain: IFM 53377 100% AB278171.1
Cephalotheca foveolata strain: PW2786 93% LC158602.1
aAccession number: identification number of nucleotide sequence from NCBI database.

세균류로 예상되는 E-1 균주의 경우엔 Staphylococcus hominis 균주들과 95% 이상의 상동성을 나타내어 S. hominis 균주로 판단되었다. S. hominis는 그람 양성균이며 사람이나 동물의 피부에서 쉽게 발견되는 박테리아로써 사람에게 무해한 세균으로 알려져 있다 [12]. 최근 연구 결과에 따르면 피부에 서식하는 S. hominis의 효소에 의하여 사람의 땀이 thioalcohols 형태로 분해되어 사람 특유의 체취를 만드는 것으로 알려졌다 [13]. 또 다른 세균류인 O-1 균주의 경우엔 Staphylococcus epidermidis 균주들과 97% 이상의 상동성을 나타내어 S. epidermidis 균주로 판단되었다. S. epidermidisS. hominis와 마찬가지로 그람 양성균이며 무해하고 사람이나 동물의 피부에서 쉽게 발견되는 박테리아로 알려져 있다 [14]. 최근에 병원성 미생물인 Staphylococcus aureus의 biofilm 생성과정을 연구하기 위해 병원성이 없지만 biofilm 생성과정은 유사한 S. epidermidis를 이용한 연구가 이루어지고 있다 [15].

곰팡이류로 예상되는 4종의 균주 중에서 A-1균주의 경우엔 Schizophyllum commune 균주들과 100% 이상의 상동성을 나타내어 담자균류 S. commune 균주로 판단되었다. S. commune는 죽은 나무 등에서 주로 발견되는 곰팡이로써 최근 면역 조절 능력, 항 곰팡이, 항 종양 및 항 바이러스 등의 특성으로 인해 의료용 연구가 활발히 이루어지고 있다 [16]. 또한 효과적인 lignocellulosic biomass의 분해능력이 알려지면서 바이오매스 분해용 효소 개발을 위한 연구가 이루어지고 있다 [17]. K-1 균주의 경우엔 Aspergillus niger 균주들과 100% 이상의 상동성을 나타내어 자낭균류 A. niger 균주로 판단되었다. A. niger는 박물관 전시실의 공기 중, 벽화 표면 및 목재 표면에서의 분포가 보고되었던 균주로 실내 공기 중에 부유하며 종이나 목재의 표면을 오염시키며 cellulose와 xylan 등의 목재 구성 물질의 탁월한 분해 능력을 가지고 있는 것으로 보고되었다 [4,6]. M-1의 경우엔 Peniophora incarnata 균주들과 96% 이상의 상동성을 나타내어 담자균류 P. incarnate 균주로 판단되었다. P. incarnata는 식물 병원성 곰팡이의 일종이며 토양 오염 원인의 하나인 polycyclic aromatic hydrocarbons을 분해하기 위한 lignin 분해효소를 효과적으로 생합성 한다고 것으로 알려져 있다 [18,19]. S. communeP. incarnata 균주는 여수 신륵사 목조 건축물의 미생물 분포 연구에서도 확인되었다는 결과가 보고되었다 [5]. M-2 균주의 경우엔 Cephalotheca foveolata 균주들과 93% 이상의 상동성을 나타내어 C. foveolata 균주로 판단되었다. Cephalotheca 는 토양이나 나무 버섯 등에 존재하며 자낭포자를 형성하는 자낭균류에 속한다 [20].

3.3. 선별된 미생물의 바이오매스 분해 활성 확인

연구를 통해 목재 및 서적류의 문화재에서 분리된 곰팡이류 4종의 바이오매스의 분해 활성을 확인하기 위해 A. niger KCTC6461과 T. reesei KCTC6968을 포함하여 총 6종의 곰팡이류를 이용하여 바이오매스 분해 활성을 측정하였다. 미생물의 경우 같은 종으로 동정되어도 매우 큰 다양성을 가지고 있으며 곰팡이의 경우 서식 장소 등에 따라 그 다양성은 훨씬 큰 것으로 알려져 있으므로 균주들의 바이오매스 분해 활성을 각각 비교하였다. 6종의 미생물 중 2종의 세균류는 LB 배지에 그리고 4종의 곰팡이류는 glucose를 제외한 YM 배지에 액체배양하여 glucose 또는 xylose가 남아있지 않게 하였으며 원심분리 후 상등액을 이용하여 분해 활성을 측정하였다. 실험에 사용된 기질로는 cellulose, CMC 그리고 xylan을 이용하였다. Fig. 1(a)의 결과와 같이 cellulose를 기질로 한 경우엔 A-1 균주의 배양액으로부터 반응 24시간 이후에 0.63 g/L의 glucose가 생성되어 분해 활성이 가장 높았으며 대표균주인 A. niger KCTC6461과 T. reesei KCTC6968의 결과보다 월등히 우수한 cellulose 분해 능력을 나타내었다. K-1, M-1, M-2의 경우엔 각각 0.07, 0.32, 0.42 g/L의 glucose 생성을 나타내었다. CMC를 기질로 사용한 경우엔 A-1과 K-1의 배양액으로부터 반응 24시간 이후에 1.20 그리고 1.08 g/L의 glucose가 생성되어 가장 높은 분해 활성을 나타내었으며 이러한 결과는 대표균주인 A. niger KCTC6461의 CMC 분해활성 결과와 대등하며 T. reesei KCTC6968의 분해 활성보다 약 2배 정도 우수한 결과이다. M-1과 M-2의 경우엔 각각 0.50, 0.38 g/L의 glucose 생성을 나타내었다. Xylan을 기질로 사용한 경우엔 K-1의 배양액으로부터 반응 24시간 이후에 3.43 g/L의 glucose와 10.18 g/L의 xylose를 생성하여 가장 높은 분해 능력을 나타내었으며 이는 대표균주인 A. niger KCTC6461의 xylan 분해 활성 결과와 대등하였다. A-1의 배양액으로부터는 3.62 g/L의 glucose와 5.31 g/L의 xylose를 생성하여 K-1의 경우보다 다소 낮은 xylan 분해 능력을 나타내었으며 이는 대표균주인 T. reesei KCTC6968의 분해 활성보다 우수한 결과이다. M-1과 M-2의 경우엔 각각 1.65, 0.93 g/L의 glucose와 2.02, 0.00 g/L의 xylose를 생성을 나타내었다.


Fig. 1. 
Cellulose (a), CMC (b), and xylan (c) degrading activities of four fungal strains (A-1, M-1, M-2, K-1) isolated in this study. Aspergillus niger KCTC6461 and Trichoderma reesei KCTC6968 were used for comparisons. Symbols; glucose (■) and xylose (□)

최종적으로 cellulose, CMC 그리고 xylan을 기질로 하여 4종류 곰팡이류의 분해 활성을 비교한 결과 A-1과 K-1 균주의 경우 대표균주들의 결과와 대등하거나 보다 우수한 분해 활성을 나타내었다. 따라서 A-1과 K-1 균주의 경우엔 바이오매스 분해효소의 생산을 위한 연구에 활용될 수 있을 것으로 기대된다. 또한 본 실험에서 선별된 2종류의 세균에 대해서도 같은 방법으로 cellulose, CMC 그리고 xylan의 분해 활성을 측정하였으나 분해 활성이 없는 것으로 확인되었다.


4. CONCLUSION

고문서 및 목재 문화재 표면의 시료로부터 동정한 균주는 총 6가지이며 그 중 곰팡이류 4종 그리고 세균류 2종이 각각 분리되었다. 분리 동정된 세균류는 S. hominisS. epidermidis으로 그리고 곰팡이류는 S. commune, A. niger, P. incarnataC. foveolata으로 확인되었다. 동정된 균주들 중에서 목재 및 서적류의 부식에 관여할 것으로 예측되는 4가지 곰팡이류의 바이오매스 분해 능력을 cellulose, CMC 및 xylan의 분해를 통해 확인하였으며 4가지 곰팡이류 중 특히 A-1과 K-1 균주가 가장 우수한 분해 활성을 나타내었다.


Acknowledgments

이 논문은 2018년도 정부 (교육부)의 재원으로 한국연구재단의 지원을 받아 수행된 기초연구사업임 (No. 2018R1A6A1A03025582), 그리고 2017년도 강원대학교 대학회계 학술연구조성비로 연구하였음 (관리번호-520170153).


References
1. Seo, M. S., C. W. Jo, S. J. Kim, Y. H. Kim, J. Y. Hong, et al, (2015), Characterization of termite inhabitation environment on wooden cultural heritages, J. Conservation Sci, 31, p387-393.
2. Bastian, F., V. Jurado, A. Nováková, C. Alabouvette, and C. Sáiz- Jiménez, (2010), The microbiology of lascaux cave, Microbiology, 156, p644-652.
3. Moon, H.-J., S.-H. Ryu, and S.-K. Kim, (2012), Measurement and application of hygrothermal properties of building materials for moisture and biological contaminations control in built environment, J. Archit Inst. Korea Plan Des, 28, p227-234.
4. Lee, M. Y., D. W. Kim, and Y. J. Chung, (2014), Conservation environmental assessment and microbial distribution of the Songsan-ri ancient tombs, Gongju, Korea, J. Conservation Sci, 30, p169-179.
5. Kim, S. H., H. J. Lee, M. Y. Lee, S. H. Jeong, and Y. J. Chung, (2017), Monitoring on biological distribution around historical wooden buildings adjacent to river - with the case study of Silleuksa temple, Yeoju city, J. Conservation Sci, 33, p267-274.
6. Seo, M. S., S. M. Lee, and J. Y. Hong, (2013), The characteristic study of the microbial habitat in the Muwisa museum, Gangjin, J. Conservation Sci, 29, p333-343.
7. Yoon, Y. M., G. H. An, J. K. Kim, S. H. Ahn, Y. L. Cha, et al, (2014), Xylanase activity of Bacillus pumilus H10-1 Isolated from Ceratotherium simum feces, KSBB J, 29, p316-322.
8. Cha, Y. L., Y. M. Yoon, H. Y. Yoon, J. K. Kim, J. Y. Yang, et al, (2015), Optimization of cellulase production from Paenibacillus jamilae BRC 15-1, KSBB J, 30, p283-290.
9. Utomo, R. N., E. Lee, and H. Yun, (2017), Solid state fermentation of Phanerochaete chrysosporium for degradation and saccharification of lignocellulose, KSBB J, 32, p96-102.
10. Payne, C. M., B. C. Knott, H. B. Mayes, H. Hansson, M. E. Himmel, et al, (2015), Fungal cellulases, Chem. Rev, 115, p1308-1448.
11. Kang, S. W., and S. W. Kim, (1994), Production of cellulase and xylanase by Aspergillus niger KKS, J. Microbiol. Biotechnol, 4, p49-55.
12. Kloos, W. E., and K. H. Schleifer, (1975), Isolation and characterization of Staphylococci from human skin II. descriptions of four new species: Staphylococcus warneri, Staphylococcus capitis, Staphylococcus hominis, and Staphylococcus simulans, Int. J. Syst. Evol. Microbiol, 25, p62-79.
13. Bawdon, D., D. S. Cox, D. Ashford, A. G. James, and G. H. Thomas, (2015), Identification of axillary Staphylococcus sp. involved in the production of the malodorous thioalcohol 3-methyl-3-sufanylhexan-1-ol., FEMS Microbiol. Lett, p362.
14. Schleifer, K. H., and W. E. Kloos, (1975), Isolation and characterization of Staphylococci from human skin I. amended descriptions of Staphylococcus epidermidis and Staphylococcus saprophyticus and descriptions of three new species: Staphylococcus cohnii, Staphylococcus haemolyticus, and Staphylococcus xylosus, Int. J. Syst. Evol. Microbiol, 25, p50-61.
15. Fey, P. D., and M. E. Olson, (2010), Current concepts in biofilm formation of Staphylococcus epidermidis, Future Microbiol, 5, p917-933.
16. Imtiaj, A., C. Jayasinghe, G. W. Lee, H. Y. Kim, M. J. Shim, et al, (2008), Physicochemical requirement for the vegetative growth of Schizophyllum commune collected from different ecological origins, Mycobiology, 36, p34-39.
17. Ohm, R. A., J. F. De Jong, L. G. Lugones, A. Aerts, E. Kothe, et al, (2010), Genome sequence of the model mushroom Schizophyllum commune, Nat. Biotechnol, 28, p957.
18. Lee, H., Y. Jang, Y. M. Lee, H. Lee, G.-H. Kim, et al, (2015), Enhanced removal of PAHs by Peniophora incarnata and ascertainment of its novel ligninolytic enzyme genes, J. Environ. Manage, 164, p10-18.
19. Lee, H., S. Y. Yun, S. Jang, G. H. Kim, and J. J. Kim, (2015), Bioremediation of polycyclic aromatic hydrocarbons in creosote-contaminated soil by Peniophora incarnata KUC8836, Biorem. J, 19, p1-8.
20. Suh, S. O., and M. Blackwell, (1999), Molecular phylogeny of the cleistothecial fungi placed in Cephalothecaceae and Pseudeurotiaceae, Mycologia, 91, p836-848.