The Korean Society For Biotechnology And Bioengineering

Current Issues

Korean Society for Biotechnology and Bioengineering Journal - Vol. 34 , No. 4

[ Research Paper ]
Korean Society for Biotechnology and Bioengineering Journal - Vol. 34, No. 4, pp.258-266
Abbreviation: KSBB J
ISSN: 1225-7117 (Print) 2288-8268 (Online)
Print publication date 31 Dec 2019
Received 26 Nov 2019 Revised 10 Dec 2019 Accepted 11 Dec 2019
DOI: https://doi.org/10.7841/ksbbj.2019.34.4.258

고초균에서 Ferritin 단백질 분비 최적화 및 산란계에서 생물학적 활성조사
이승우1 ; 김민주1 ; 최장원1, *
1대구대학교 대학원 자연자원학과

Secretional Optimization of Ferritin Protein in Bacillus subtilis and Its Biological Activity in Laying Hen
Seung woo Lee1 ; Min ju Kim1 ; Jang Won Choi1, *
1Department of Natural Resources Graduate School, Daegu University, Gyeongsan 38453, Korea
Correspondence to : *Department of Natural Resources Graduate School, Daegu University, Gyeongsan 38453Korea Tel: +82-53-850-6756, Fax: +82-53-850-6759 e-mail: chjawo@daegu.ac.kr


© 2019 The Korean Society for Biotechnology and Bioengineering
Funding Information ▼

Abstract

In order to maximize the production and secretion of ferritin protein, the replication origin (0.5 kb) of the pRBASFer (6.93 kb) which was already constructed was amplified using PCR and introduced into the pRBASFer vector with tandem arrangement. Finally, the recombinant pRBASFer-ori (7.43 kb) vector with two replication origins was newly constructed. And then, two type of the recombinant vectors (pRBASFer and pRBASFer-ori) containing aprE promoter, aprE signal sequence and ferritin gene were transferred to Bacillus subtilis LKS87, respectively and the right transformant were confirmed by restriction enzyme digestion, PCR amplification and DNA sequencing. The effect of additional replication origin on the secretion of ferritin protein was investigated according to various culture conditions and the secretion levels of ferritin were analyzed in SDS-PAGE and western-blot. As a result, the secretion level of ferritin protein in B. subtilis LKS87 harboring the pRBASFer-ori vector was increased to approximately 20% of total secreted proteins (165 μg/mL) more than that of pRBASFer vector. Maximum level of the ferritin secretion was accomplished in batch culture as followings: 2% soy peptone as nitrogen source, 2% barley as carbon source, and 48 h incubation time. Mass production of the ferritin was carried out using 50 L fermenter under the optimal conditions established in batch culture. The liquid type of feed additive containing the ferritin was formulated and the biological activity was tested by its administration to drinking water in laying hens, resulting in the improvement (10%) of all index related to eggshell color, egg weight and Haugh unit, indicating that the liquid type feed show the possibility as new feed additive in laying hen to increase egg quality.


Keywords: Bacillus subtilis, egg quality, ferritin, feed additive, replication origin

1. INTRODUCTION

철은 산소 운반 및 저장 기능을 하는 페리틴, 트랜스페린, 헤모글로빈, 미오글로빈 등의 구성성분이며, 전자전달계 단백질 및 독성물질 제거에 관여하는 페록시다제 등의 필수성분으로서 생체 내에서 생명 유지에 중요한 역할을 한다. 따라서 세포 내에서 대표적 철 저장 단백질인 페리틴 (ferritin)은 모든 생물종, 즉 사람을 포함하여 동물, 식물, 미생물 등여러 생물체에 존재하는 것으로 보고되었다 [1]. 사람 및 척추동물의 페리틴은 유전적, 기능적으로 다른 두가지 형태의 subunit, H (heavy/heart) type과 L (light/liver) type으로 구성되어 있으며 조직에 따라 그 조성비율이 다른 여러 이소페리틴 (isoferritin)으로 존재하지만, 무척추동물의 경우에는 H (heavy) type 만 존재하는 것으로 보고되었다. L type subunit은 페리틴 분자의 내공을 형성하는데 관여하며, H type subunit은 Fe+2의 흡수에 필요한 페록시다제 (ferroxidase) 활성을 가지고 있어 페리틴 흡수 촉진 및 Fe+2의 산화 촉진 활성을 가지고 있고, 또한 H 형이 풍부한 페리틴은 철분 운반의 기능이 높은 것으로 보고되었다 [2-3]. 무기물 철분 제제는 철분 흡수 효율이 낮고 위염, 소화장애 등 부작용이 심해 철분 결핍증의 주요 대상이 유아 및 임산부임을 고려할 때사용에 많은 제약을 갖는다. 이를 대체할 제제는 페리틴으로 철분 결핍성 빈혈의 치료에 쓰이고 있어 무기물 제제보다 부작용이 작고 훨씬 효과가 있는 것으로 알려져 있다. 현재까지 효모 및 대장균에서 유전자 재조합 페리틴의 생산을 위한다양한 연구가 진행되어 왔지만, 대부분 페리틴의 이형집합체의 발현 및 정제에 관한 것이었고, 또한 사료첨가제로 사용하기 위한 시도는 있었지만 발현 수율이 낮고 생물학적 활성 면에서도 그다지 좋은 효과를 주지 못한 것으로 보고되었다 [4-8]. 흰이빨 참갯지렁이로부터 H-type의 페리틴 유전자가 분리되었고 (GenBank accession number DQ207752), 페리틴 단백질은 신호서열 17개 아미노산을 포함하여 174개 아미노산으로 구성된 18.2 kDa의 H-type subunit 24개가 결합하여 multimer를 형성하는 것으로 보고되었으며 [9-11], 그분자 중심에 형성된 내공 (core)에는 옥시하이드로사이드 폴리머 (oxyhydroxied polymer)가 있어 분자 당 헤모글로빈 1,200 분자를 생합성 할 수 있고, 4,500개의 철원자 (3가 철)를 저장 할 수 있어 철 저장 단백질로서 다른 무기물 제제보다 부작용이 작고 훨씬 효과가 있는 것으로 알려져 있다. 따라서 갯벌생명체로부터 분리한 한 종류의 페리틴 (H-type) 유전자를 사용하여 효율적으로 고발현, 고분비 시스템을 개발하여 페리틴을 대량생산하고, 생산된 발효액을 사용하여 용도에 따른 제형화를 거쳐 기존의 사료에 첨가하여 생물학적 활성을 유도하는 기술의 개발이 필요한 실정이다.

고초균 (Bacillus subtilis)은 대표적인 그람 양성균으로 염색체내 DNA 염기서열이 완전 규명되어 유전자 발현 및 조절에 필요한 요소들이 많이 알려져 있다. 안정성이 입증된 GRAS (generally regarded as safe) 균주로서 세대시간이 빠르며, codon bias경향을 보이지 않아 유전자 조작이 용이하며, 전통적인 발효 과정에서 고초균 자체적으로 효율성이 높은 단백질 분비 시스템을 가지고 있어, 많은 양의 외래 유용 단백질을 분비시킬 수 있는 가능성이 높고, 세포 외로 분비된 단백질은 회수가 용이하여 이종 단백질 생산의 주요 숙주세포로 많이 사용된다 [12-15].

따라서 본 연구에서는 무척추동물인 흰이빨참갯지렁이 (Periserrula leucophryna)에서 얻어진 페리틴 유전자를 더 효율적으로 발현 및 분비를 위하여 promoter, Shine-dalgarno (SD), operator, 신호서열 및 replication origin 등의 주요 조절인자들을 포함하는 발현분비벡터 [16]로 추가적인 replication origin을 도입하여, 즉 고초균의 copy number를 증가시켜 발현 및 분비를 최적화하고 발효조를 이용하여 철분단백질을 대량생산하여 얻어진 단백질을 액상으로 제형화하여 산란계에서 생물학적 활성을 조사하였다.


2. MATERIALS AND METHOD
2.1. 재료 및 시약

제한 효소와 T4 DNA ligase는 Elpisbio (Daejeon, Korea)으로부터, Taq polymerases는 Applied Biosystem (Foster, CA, USA), NEB (Beverly, MA, USA) 및 Bacto-agar과 tryptone, yeast extract은 Merck (Lutterworth, Germany)로부터 구입하였고, Oligonucleotides는 Bioneer (Daejeon, Korea)에서 합성하였다. Immobilon-P PVDF 막은 Millipore (Bradford, MA, USA)로부터, pGEM-Teasy cloning kit과 Wizard Plus SV Minipreps DNA purification kit는 Promega (Madison, Wisconsin USA)에서 QIAEX agarose gel extraction kit는 Q iagen (Hilden, Germany), ECL western blotting system는 A mersham Pharmacia biotech (Piscataway, NJ, USA)에서, SDS, NaCl, RNaseA, ampicillin, kanamycin은 Sigma-Aldrich (St Louis, MO, USA), Polyclonal 항체는 Santa Cruz Biotechnology사 (Santa Cruz, CA USA)사로부터 구입하였다. 나머지 시약들은 분석용 수준급을 사용하였다.

2.2. Bacterial strains, plasmid 및 medium

Plasmid의 증식을 위한 균주로 E. coli XL1-Blue MRF (F', proAB, lacIqZ△M15, thi, recA, gyrA, relA, supE, Tn10) (Stratagene, La Jolla, CA) 사용하였고, pGEM-T Easy vector (Promega, Madison, USA)는 PCR 산물을 클로닝하기 위해, 외래 단백질 발현 및 분비를 위한 숙주세포로는 Bacillus. subtilis 168 (wild type, GRAS and genome sequenced strain) 균주로부터 gene conversion에 의한 변이 실험에 의해 구축된 Bacillus subtilis LKS87 (nprR2, nprE18, aprA3, amyE) 균주를 사용하였다 [17]. 기존 pRBASFer (Ampr, Neor, bler, repB, ColE1 ori, aprE-P, apr signal sequence, ferritin gene) [16] 벡터에 replication origin을 추가적으로 첨가하여 ferritin 유전자를 함유하는 pRBASFer-ori 발현 및 분비 vector를 본연구에서 제조하였다. 재조합 vector를 보유한 E. coli 형질전환체는 ampicillin (50 μg/mL)을 첨가 후 Luria-Bertani (LB) [18] 배지에서 37℃, 16시간 200 rpm으로 배양하였고, 재조합벡터가 포함된 고초균 (Bacillus subtilis)은 kanamycin (50 μg/mL)를 첨가한 LB 배지를 37oC에서 전 배양 후, kanamycin (50 μg/mL)이 첨가된 PY [19] 배지에서 1% 접종 후 30oC에 배양하였다.

2.3. 재조합 분비벡터 구축 및 Bacillus subtilis 형질전환

Replication origin을 추가적으로 도입하기 위하여 그 origin 서열 특이적으로 제작된 oligonucleotide 프라이머 세트 (Forward primer: 5'GGGACATGTTCTTTCCTGCGTTATCCCCTG3', Reverse primer: 5'CCCGATATCCTATTTAGAATATTGTTTAGT3') 를 사용하여 PCR (Techne, Vantaa, Finland)에 의해 DNA를 증폭하였다. Replication origin은 다음과 같은 조건으로 (95oC-5 min, 45oC-1 min, 72oC-10 min (1 cycle); 95oC-1 min, 45oC-30 sec, 72oC-1.5 min (29 cycles); 72oC-10 min (1 cycle) PCR을 수행하였으며 PCR 산물은 1% agarose gel에서 분획하고 DNA 단편을 회수한 후 (Qiaquick gel extraction kit, Hilden, Germany), pGEM-Teasy 벡터 (Promega, Madison, WI)에 클로닝하였다 [18]. 추가적인 replication origin을 갖는 재 조합 벡터를 구성하기 위하여 pRBASFer 벡터를 MluI 효소 처리 후 filling 하고 PciI 효소로 절단하였으며, replication origin 유전자를 함유하는 T-pRBori 클론은 EcoRV 및 PciI으로 절단하여, 508 bp의 DNA 단편을 겔로부터 확보하였다. 얻어진 DNA 단편들은 ligation 한 후 E. coli XL-1 Blue MRF '로 형질전환하여 선별하였으며 제한효소 (EcoRV and PciI)로 처리하여 도입된 유전자를 확인하였고, 최종적으로 확인된 클론은 pRBASFer-ori (7.4 kb)로 명명하였다. 고초균에 형질전환은 SPMM-I (Spizizen's minimal medium)과 SPMM-II 배지를 사용하는 Sadaie and Kada [20] 방법에 의해 진행하였고, kanamycin (50 μg/mL)이 들어간 LB 고체배지에서 형질전환체를 선별하여 페리틴 단백질 발현 및 분비를 위하여 사용하였다.

2.4. 단백질 발현 분비 및 대량배양

Repliaction origin이 추가적으로 도입된 pRBASFer-ori 발현벡터를 함유하는 Bacillus subtilis LKS87의 형질전환체는 b atch culture (500 mL baffled flask)에서 배지, 온도, 배양시간에 따라 페리틴 생산의 최적화를 시도하였고, 이때 얻어진최적의 조건하에서 5 L jar fermenter (KoBiotech, Korea) 및 50 L fermenter를 이용하여 대량 배양하였다.

2.5. SDS-PAGE 및 western blot 분석

얻어진 배양액을 직접적으로 또는 에탄올 침전에 의해 농축하여 2x sample buffer (0.05 M Tris-HCl, pH 6.8, 0.1 M DTT, 2% SDS, 10% glycerol, and 0.1% bromophenol blue)에 현탁하여 100oC에서 10분 가열 후 12% SDS-PAGE (sodium-dodecyl sulfate polyacrylamide gel electrophoresis)에 의해 분획한 다음, BSA (bovine serum albumin)를 standard로 하여 Bradford protein assay kit (Bio-Rad, Hercules, CA, USA)를 사용하여 정량 하였다 [21]. 배양액 내의 단백질들을 SDS-PAGE에서 fractionation 후, Trans-Blot SD apparatus (Bio-Rad, Hercules, CA, USA)를 이용하여 SDS-PAGE에서 단백질들을 PVDF membrane으로 이동시킨 다음, TBST (10 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% Tween-20)에 skim milk를 5% 농도로 첨가하여 4oC에서 overnight blocking 시켰다. 그 후, 1차항체인 rabbit polyclonal anti-ferritin antibody (1:1,000 dilution, Santa Cruz Biotechnology, Dallas, Texas)으로 1시간동안 반응시킨 다음, 결합되지 않은 1차 항체는 TBST 용액으로 세척하여 제거한 다음 2차 항체인 horseradish peroxidase-conjugated anti-rabbit IgG secondary antibody (1:1000, Santa Cruz Biotechnology)으로 1시간동안 반응한 후, ECLTM Western blotting detection system (Amersham Pharmacia Biotech, USA)을 이용하여 X-ray 필름에 감광하였다. 그 blot을 스캔하여 ChemiImager™ (Alpha Innotech Corporation, San Leandro, USA)로 단백질의 농도를 간접적으로 비교 측정하였다.

2.6. 산란계를 이용한 생물학적 활성 확인

pRBASFer-ori이 형질 전환된 고초균을 최적화된 배지에서 50 L fermenter를 이용하여 대량 생산 후, 연속 원심분리기를 사용하여 균을 제거하고 발효액을 회수하였다, 발현 분비된 ferritin을SDS-PAGE에 의해 fractionation하여 western blot에 의해 확인하였고, 최종적으로 Bradford [21] 방법에 의해 정량 하였다. Ferritin을 포함하는 발효액을 적절한 농도 (10 μg/mL)로 희석 후 자동 급수 시설을 갖춘 산란계 농장 (대구대농장)에서 음용수에 0.1%로 첨가하여 산란계 (ISA Brown, 80주령, 300수)에 6주 동안 취음 시킨 후 매주 무작위로 계란 60개를 선택하여 난각색, 난중, haugh unit (HU)을 대조군 그룹과 함께 정성 및 정량적으로 측정하여 비교 분석하였다 [22-23].

2.7. 고주파 유도결합 플라즈마 방출 분광법 (ICP)을 통한 철 (ferric) 정량

수집한 난각과 난황은 대구대학교 중앙기기원에 의뢰하여 ICP (inductively coupled plasma)-OES system 기기를 사용하여 철분 함량을 측정하였다. 즉, 전처리 과정은 마이크로웨이브 (CEM Corporation, Charlotte, USA)를 이용하여 제조하였고, 즉 난각 0.5 g과 질산 10 mL을 첨가한 후, 열판에서 190 ℃로 20분 동안 가열하였다. 난각에 De-ionized water 50 mL을 넣고, OPTIMA 7300DV ICP-OES SYSTEM (Carnation, Washington, USA)을 사용하여 고주파 유도결합 플라즈마 방출 분광법 (ICP)을 이용하여 철분 함량을 분석하였다.


3. RESULTS AND DISCUSSION
3.1. 추가적 replication origin을 포함하는 분비벡터 구축

Alkaline protease promoter (0.45 kb) 및 alkaline protease signal sequence (87 bp), 리보솜결합서열 (GGAGAGGG)을 갖는 p RBAS-Fer (6.9 kb) [16] 벡터의 자체replication origin을 추가로 도입하여 copy number를 증폭시키기 위하여 제한효소부위 (PciI 및 EcoRV)가 도입된 replication origin 특이적primer (Ori-F 및Ori-R)를 이용하여 pRBAS-Fer 벡터를 주형으로 PCR에 의해 0.5 kb DNA단편을 얻은 후, pGEM-Teasy 벡터에 클로닝하여 선별한 다음 DNA 염기서열 분석에 의해 도입된 replication origin 서열을 확인하고 T-pRBori (3.51 kb)로 명명하였다 (Fig. 1). 기존 벡터 pRBAS-Fer를 MluI으로 자른 후 Klenow 효소로 filling하고 다시 PciI으로 자른 다음 agarose gel에서 DNA 단편을 준비하였다. 또한 T-pRBori 벡터를 EcoRV와 PciI로 잘라 508 bp의 replication origin 단편을 준비한 다음, 상기 linearized vector와 ligation하여 대장균에 형질전환시켜 얻은 형질전환체들로부터 DNA size 선별 및 염기서열 분석에 의해 replication origin이 tandem 배열로 도입된 재조합 분비벡터를 구성하였고 pRBASFer-ori (7.43 kb)로 명명하였다 (Fig. 1). 이와 같이 구축된 재조합 분비 벡터 pRBASFer-ori는 대장균에서 증폭하여 고초균 형질전환을 위하여 사용하였다.


Fig. 1. 
Construction of secretion vector containing additional replication origin, pRBASFer-ori.

3.2 고초균에서 단백질 발현 및 분비 최적화

재조합된 분비 벡터 pRBASFer-ori는 B. subtilis LKS87에 SPMM-I (Spizizen's minimal medium)과 SPMM-II 배지를 사용하는 Sadaie and Kada [20] 방법으로 도입하였고, kanamycin (50 μg/mL)을 첨가한 LB 고체배지에서 형질전환체를 선별후, plasmid를 분리하여 PCR에 의해 도입된 replication origin을 다시 확인하였다. 도입된 ferritin 유전자는 mature form 157개의 아미노산에 대한 정보를 가지고 있으며 [9], amylase 신호서열 연결부위에 도입된 HindIII 제한효소부위에서 유래된 AAG (Lys), CTT (Leu) 2개의 아미노산을 포함 159개의 ferritin (18 kDa) 단백질이 세포 외로 분비될 것으로 추정되었다. 그러나 2개의 아미노산이 첨가되어 페리틴 활성에 영향을 줄 수 있으므로 2 아미노산에 대한 coding 염기들을 제거하기 위하여 특이적 primer를 합성하여 PCR에 의해 2개의 codon을 제거하였고 (data not shown), 원래 mature form 페리틴이 amylase 신호서열 (29 아미노산)이 정확히 peptidase에 의해 processing 되어 제거된 후 분비되었다 (Fig. 2, Fig. 3). 재조합 pRBASFer [16] 및 pRBASFer-ori (in this study)을 각각 B. subtilis LKS87에 도입하여 얻은 형질전환체들 (각각 5종)에서 페리틴 분비효율을 비교하기 위하여, kanamycin (50 μg/mL)이 첨가된 10 mL LB 배지에서 활성 시킨 후, 500 mL baffled flask 내에 (100 mL working volume) PY 액상 배지를 사용하여 30oC에서 48 시간동안 배양하여 분비된 페리틴 양을 SDS-PAGE에서 densitometer로 비교 하였을 때, 기존 벡터, pRBASFer을 함유하는 고초균 형질전환체 (No1-5)에서는 페리틴이 총단백질의 ~10-11% 정도 분비되었고, pRBASFer-ori 함유 고초균 형질전환체 (No. 1-5)에서는 총단백질의 ~15-18% 까지 증가하여 페리틴 단백질의 분비 효율이 평균적으로 1.4-1.8배까지 증가한 것으로 나타났다 (Fig. 2). 이는 추가적인 replication origin 도입에 의한 효과로 보이며 copy number 증가에 의한 RNA 전사체 양의 증가에 따른 단백질양 증가라고 추정해 불 수 있다. 그림 2B의 pRBASFer-ori 함유 고초균 형질전환체들중에서 페리틴 단백질 분비 효율이 가장 좋은 (전체단백질의 ~18%) transformant 5번 균주를 이용하여 질소원 및 탄소원 변화에 따른 페리틴 생산양을 조사하였다. 여러 질소원 (Soy peptone, Peptone, Potassium nitrate, Corn steep liquor, defatted soybean meal, soy protein isolate)들을 1-4% 농도로 기본배지에 첨가하여 48시간 배양한 후, 발효액을 이용하여 단백질을 분석하였을 때 soypeptone (2%)을 사용하였을 때 다른 질소원들에 비해 가장 높은 수준 (전체단백질의 ~20%)으로 분비되었고, Bacillus. subtilis 168 (wild type)에 pRBASFer-ori를 도입한 형질전환체에서 페리틴을 분비했을 때 (data not shown) 와는 달리 배양시간이 길어져도 단백질 분해효소에 의한 페리틴 분해가 일어나지 않는 것으로 보여진다 (Fig. 3(A)). 이는 사용한 B. subtilis LKS87 (nprR2, nprE18, aprA3, amyE) 균주의 경우 2 종류의 protease 유전자가 결여 되어 고초균 성장단계에서 휴지기에 도입하는 배양시간에도 다른 단백질 분해효소들의 활성화에 의해 외래단백질의 부분적인 분해를 유발하지 않는는 것으로 사료된다 [13-16]. 또한 대량배양의 경우 질소원의 원료 가격을 고려할때 현실적으로 높은 농도의 soypeptone을 사용 한다는 것은 단가에 큰 영향을 미치므로 기본적인 PY배지 [19]의 질소원 soypeptone을 2%로 고정하고, 탄소원 (glucose, glycerol, barley, starch, molasses)들을 각각 1-2%로 첨가하여 탄소원에 의한 페리틴 분비효과를 측정한 결과, 그림 3B에서 보는 바와 같이 2% glucose (전체단백질의 21%)와 barley (전체단백질의 21.5%) 에서 가장 분비 효율이 좋은 것으로 나타났다. Batch culture에서 확립된 배양 조건이 대량 생산을 위한 조건과 정확히 같을 수는 없지만 얻어진 결과를 토대로 적정 온도 (30oC), 최적화된 배지 (PY 배지+ 2% soy peptone and 2% barley)에서 5 L jar-fermenter 및 50 L 발효조에서 배양시간에 따른 세포밀도 및 페리틴 분비량을 측정하였다.


Fig. 2. 
Secretional efficiency of the ferritin protein by pRBASFer (A) and pRBASFer-ori (B) in B. subtilis LKS87. lane 1, MW marker; lane 2, pRBAS vector only; lane 3, ferritin (positive control); lane 4-8, transformant 1-5. The arrows indicate the position of the ferritin.


Fig. 3. 
Secretional efficiency of the ferritin by change of nitrogen and carbon sources. (A) Effects of nitrogen sources: lane 1, MW marker; lane 2, ferritin (positive control); lane 3, soy peptone; lane 4, peptone (Merck); lane 5, potassium nitrate; lane 6, corn steep liquor; lane 7, defatted soybean meal; lane 8, soy protein isolate. (B) Effects of carbon sources: lane 1, MW marker; lane 2, pRBAS vector only; lane 3, ferritin (positive control); lane 4, glucose; lane 5, glycerol; lane 6, barley; lane 7, starch; lane 8, molasses. B. subtilis LKS87 harboring pRBASFer-ori was cultured in 100 mL of PY medium using 500 mL baffled flask.

3.3. 대량배양 및 단백질 분석

고초균 형질전환체 (pRBASFer-ori 함유)를 최적화된 배지에서 5 L jar fermenter를 사용하여 30oC, 200 rpm 및 1 vvm 조건하에서 72시간동안 배양하여 세포밀도 및 페리틴 분비량을 측정하였다 (Fig. 4). 그림 4A에서 보듯이 세포밀도는 60시간째에 도달할 때 가장 높은 최대치 (OD600 = 8.61)에 도달하였고, 배양시간에 따른 페리틴 단백질의 분비량은 12시간째 (28.8 μg/mL)부터 증가하기 시작하여 60시간 배양시간에서 165.4 μg/mL로 가장 많이 분비된 것으로 나타났다. 따라서 페리틴 생산 및 분비는 세포밀도와 비례하여 증가하는 것으로 나타났고 단백질분해효소에 의한 외래단백질 분해현상은 보이지 않았다. 이와 같은 결과를 바탕으로 하여 산업적인 용도로 활용을 하기 위하여 50 L fermenter에서 대량 배양을 시도하였다. 대량배양 50 L (working volume 30 L)는 5 L jar fermenter에서와 마찬가지로 pRBASFer-ori를 함유하는 B. subtilis LKS87를 최적화된 배지 (PY + 2% soypeptone + 2% barley)에 1%로 접종하여 30oC, 150 rpm 및 1 vvm 조건하에서 72 시간동안 배양하여 세포밀도 및 페리틴 분비량을 측정하였다 (Fig. 5). 그림 5A에서 보듯이 세포밀도는 배양시간에 따라 증가하여 60시간에 도달했을 때 최대치 (OD600 = 6.61)에도달하였고, 페리틴 단백질 분비량도 12시간째 (12.8 μg/mL)부터 증가하기 시작하여 60 시간 배양시간에서 102.4 μg/mL로 가장 많이 분비된 것으로 나타났다. 같은 시간 (60시간)대에 5 L jar fermenter에서 (165.4 μg/mL) 보다는 약 38% 정도는 감 소한 것으로 보이지만 이는 교반속도 차이에 의한 용존 산소공급의 감소에 기인 [16] 하는 것으로 예상되었고, 그러나 1회 발효에 의한 전체 양적인 면에서는 축종에 따른 투여 적정농도 (dose)에 맞도록 처리할 수 있는 충분한 페리틴 단백질을 확보할 수 있었다. 발효가 끝난 후 연속 원심분리기에 의해 균체를 제거하고 발효액을 회수하여 본 사료 및 음용수에 0.1% 정도로 투여할 수 있도록 액상 형태의 사료첨가제를 제조하였으며 (6 μg/mL), 산란계에서 계란의 품질에 미치는 효과를 측정하여 페리틴 단백질의 생물학적 활성 (철분강화제)을 조사하였다. 또한 50 L 발효조를 이용한 페리틴 생산에서도 5 L jar fermenter에서와 같이 단백질분해효소에 의한 페리틴 분해는 관찰되지 않았다.


Fig. 4. 
Time profiles of the ferritin production in B. subtilis LKS87 harboring pRBASFer-ori using 5 L jar-fermenter. Soy peptone (2%) and Barley (2%) were added in PY medium. The cells were incubated at 30oC for 72 h. The samples were collected every 12 h and the secreted ferritin proteins were analyzed: (A) Changes of the secreted ferritin protein and cell growth by time intervals (B) SDS-PAGE and Western blot analysis: lane 1, MW marker; lane 2, ferritin (positive control); lane 3, pRBASFer-ori (6 h); lane 4, pRBASFer-ori (12 h); lane 5, pRBASFer-ori (24 h); lane 6, pRBASFer-ori (36 h); lane 7, pRBASFer-ori (48 h); lane 8, pRBASFer-ori (60 h); lane 9, pRBASFer-ori (72 h).


Fig. 5. 
Time profiles of the ferritin production in B. subtilis LKS87 harboring pRBASFer-ori using 50 L fermenter. Soy peptone (2%) and Barley (2%) were added in PY medium. The cells were incubated at 30oC for 72 h. After collecting the samples every 12 h, the secreted ferritin proteins were analyzed: (A) Changes of the secreted ferritin protein and cell growth by time intervals (B) SDS-PAGE and Western blot analysis: lane 1, MW marker; lane 2, ferritin (positive control); lane 3, pRBASFer-ori (6 h); lane 4, pRBASFer-ori (12 h); lane 5, pRBASFer-ori (24 h); lane 6, pRBASFer-ori (36 h); lane 7, pRBASFer-ori (48 h); lane 8, pRBASFer-ori (60 h); lane 9, pRBASFer-ori (72 h).

3.4. 산란계에서 페리틴의 생물학적 활성

일반적으로 사용하는 철분 사료는 인산 칼슘, 황산 제1철과 같은 무기물 첨가 사료이지만, 철의 소화 흡수에서는 무기태철보다 유기태 철이 생체 이용성이 크다고 보고 되어있다 [24-28]. 따라서 유기철을 보유한 페리틴 액상 형태의 사료첨가제 (6 μg/mL)를 산란계 (ISA Brown, 80주령, 300수) 농장의 자동 급수 시설을 이용하여 음용수의 0.1%에 해당하는 양을 6주 동안 자유롭게 취음 시킨 후 무작위로 매주 계란 60개를 취득하여 난각색, 난중 무게, haugh unit (신선도), 난각 및 난중의 철분함량 등을 분석하였다. 사육기간 동안 음용수의 양을 측정한 결과, 하루 평균 산란계 한 마리가 취음하는 음용수가 약 400 mL, 즉 6주 동안 300마리에 투여한 음용수가 약 5,040 L 사용되었으며, 이에 필요한 ferritin 단백질 (6 μg/mL)은 5.04 L (30.3 mg 페리틴) 정도 필요한 것으로 측정되었다. 페리틴을 함유한 음용수를 6주 동안 투여한 후 난중의 무게를 측정한 결과, 그림 6A에서 보는 바와 같이 매주 증가하는 추 세를 보였고, 6주 후 난중 (66.46 g)의 무게는 대조군 난중 (57.82 g) 보다 15% 정도 증가하는 것으로 나타났다. 난각색은 색좌표 CIE (L*a*b*)를 이용하여 분석한 결과, 페리틴 투여 전 대조군 난각색은 연한 갈색 (73.23, 9.55, 25.72)이였으며, 6주 후 난각색은 진한 갈색 (65.23, 18.39, 32)으로 약 17% 정도 진한 갈색으로 변하였다 (Table 1Fig. 6(B)). Haugh unit (HU, 신선도)은 Table 1에 따르면 대조군 (64.44) 보다 6주간 투여한 계란 (70.52)이 8% 증가한 것으로 나타났다. 또한 난각 및 난황에 함유되어 있는 철분을 ICP (inductively coupled plasma)을 이용하여 분석한 결과, 그림 7C에서 보는 바와 같이 대조군 보다 6주 동안 투여한 난각 및 난황의 철분 함유량이 각각 15.7배, 24배 높게 나타났다. 전체적으로 볼 때 사육농장의 환경조건에 따라 약간의 차이는 있지만 페리틴 액상제제의 첨가는 계란의 품질, 즉 난중의 무게, 난각 및 난황색, 철분 함유량 및 신선도에 큰 영향을 미치는 것으로 보여진다.

Table. 1. 
Field test for biological activity of ferritin (liquid type) in laying hens
Sample Eggshell color W Height of egg white Height of yolk sac Egg white diameter Yolk sac diameter Albumin index Yolk index Haugh unit
L* a* b* g mm mm Mm mm
Control 73.23
(±1.1)
9.55
(±1.4)
25.72
(±1.0)
57.82
(±1.8)
4.50
(±0.6)
15.63
(±0.6)
69.35
(±0.6)
38.98
(±0.6)
0.06
(±0.01)
0.40
(±0.02)
64.44
(±2.73)
6 weeks 62.53
(±1.1)
18.39
(±1.5)
32.00
(±1.1)
66.46
(±1.6)
5.56
(±0.3)
18.57
(±0.5)
75.52
(±0.6)
40.6
(±0.6)
0.07
(±0.01)
0.46
(±0.01)
70.52
(±1.32)
Haugh unit : 100 × log (h-1.7ω0.37+ 7.6)
W : Egg weight


Fig. 6. 
Effects of ferritin protein on the egg quality. Eggs were collected every week and eggshell color, egg weight and Haugh unit were analyzed; (A) Biological activities of the ferritin on egg qualities (eggshell color, egg weight and haugh unit) for 6 weeks. (B) Changes of eggshell colors during 1st- 6st periods after administration of ferritin broth. (C) Analysis of ferric amounts in egg shell and yolk using ICP (inductively coupled plasma).


4. CONCLUSION

본 연구에서는 흰이빨참갯지렁이 유래 철분 단백질, 페리틴을 산업적으로 이용하기 위해 고초균에서 분비효율을 최적화하여 대량배양 하였고, 균을 제거한 배양액을 사료첨가제로 활용하기 위한 시스템을 구축하였다. 기존에 구축된 pRBASFer 분비벡터 [16]에 copy 수 증가를 위해 replication 부위를 병렬 방식으로 추가 후, 구성된 pRBASFer-ori 벡터를 B. subtilis LKS87에 도입한 다음, 페리틴 단백질 생산을 최적화하여 생산 수율이 1.4배 정도 증가하였다. 산란계에서 페리틴의 생물학적 활성을 검증하기 위해 액상형태로 제형 후음용수에 첨가한 다음, 산란계의 계란 품질에 주요 지표가되는 난각색, 신선도, 난각 및 난황 내 철분함량을 측정한 결과 모든 수치가 증가하였다. 특히 철 함유량 측정 시 난각에서는 대조군에 비해 11 ~ 15.7배, 난황에서는 8.5 ~ 24배까지증가한 것으로 나타났다. 따라서 페리틴 함유 발효액은 사료첨가제로서 충분한 생물학적 활성을 가지므로 사료 분야에서 경쟁력을 가질 수 있을 것이라 전망되며, 철 결핍 예방 및 치료용을 위한 식품 산업, 의약소재산업 등의 분야에서도 유용하게 사용될 것이라 예상된다. 또한 차후에 생산 효율을 증가시키기 위해 신규 promoter 추가도입 및 신호 서열을 조합하여 분비를 극대화 할뿐만 아니라 대량생산의 최적화에 의한 산업적 용도의 제형화 및 안정성 증진을 위한 연구를 진행할 예정이다.


Acknowledgments

이 논문은 대구대학교 연구 장학기금 지원에 의한 것임.


References
1. Andrew, S. C., P. Arosio, W. Bottke, J. F. Briat, M. von Darl, P. M. Harrison, J. P. Laulhe`re, S. Levi, S. Lobreaux, and S. J. Yewdall (1992) Structure, function, and evolution of ferritins. J. Inorg. Biochem. 47: 161- 174.
2. Baynes, R. D. and T. H. Bothwell (1990) Iron deficiency. Annu. Rev. Nutr. 10: 133-148.
3. Theil, E. C. (1990) Regulation of ferritin and transferrin receptor mRNAs. J. Biol. Chem. 265: 4771-4774.
4. Park, H. K., Y. S. Huh, J. W. Lee, and I. H. Kim (2002) Purification of heavy Chain ferritin (FH) from recombinant E. coli. Kor. J. Biotechnol. Bioeng. 17: 44-451.
5. Lee, J., S. W. Kim, Y. H. Kim, and J. Y. Ahn. (2002) Active human ferritin H/L-hybrid and sequence effect on folding efficiency in Escherichia coli. Biochem Biophys Res Commun. 298: 225-229.
6. Chang, Y. J., C. U. Park, and K. S. Kim (2004) Iron uptake by the recombinant yeasts producing ferritin heteropolymers. Kor. J. Biotechnol. Bioeng. 19: 352-357.
7. Lee, J. L., R. E. Levin, and H. Y. Kim (2008) Improved coexpression and multiassembly properties of recombinant human ferritins subunit in Escherichia coli. J. Microbiol Biotechnol. 18: 926-932.
8. Seo, H. Y., Y. J. Chung, S. J. Kim, C. U. Park, and K.S. Kim (2003) Enhanced expression and functional characterization of the human ferritin H- and L-chain genes in Saccharomyces cerevisiae. Appl Microbiol Biotechnol. 63: 57-63.
9. Jeong, B. R., S. M. Chung, N. J. Baek, K. B. Koo, H. S. Baik, H. S. Joo, C. S. Chang, and J. W. Choi (2006) Characterization, cloning, and expression of the ferritin gene from the Korean polychaete, Periserrula leucophryna. J. Microbiol. 44: 54-63.
10. Theil, E. C. (1987) Ferritin : structure, gene , regulation, and cellular function in animals, plants, and microorganisms. Annu. Rev. Biochem. 56: 289-315.
11. Harrison, P. M. and P, Arosio (1996) The ferritins: molecular properties, iron storage function and cellular regulation. Biochim. Biophys. Acta. 1275: 161-203.
12. Park, K. I (2007) Secretion of the Periserrula leucophryna ferritin in Bacillus subtilis and its optimization. Master thesis, Graduate School Daegu University.
13. Schallmey, M., A. Singh, and O. P. Ward (2004) Developments in the use of Bacillus species for industrial production. Can. J. Microbiol. 50(1): 1-17.
14. Westers, L., H. Westers., and W. J. Quax (2004) Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism. Biochim. Biophys. Acta. 1694: 299-310.
15. Nijland, R and O. P. Kuipers (2008) Optimization of protein secretion by Bacillus subtilis. Recent Pat. Biotechnol. 2(2): 79-87.
16. Choi, J. W. (2016) Secretion of ferritin protein of Periserrula leucophyryna in Bacillus subtilis and its feed efficiency. KSBB journal. 31: 105-112.
17. Kim, S. I., J. W. Choi, and S. Y. Lee (1997) Effects of pleiotrophic mutations, degUh and spoOA, on the production of foreign proteins using the heterologous secretion system of Bacillus subtilis. Mol. Cells. 7: 158-164.
18. Sambrook, J., E. F. Fritsch, and T. Maniatis (1989) In Molecular cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press.
19. Lee, M. H., J. J. Song, Y. H. Choi, S. P. Hong, E. H. Rha, K. Kim, S. G. Lee, S. C. Lee, H. Poo, Y. B. Seo, and M. H. Sung (2003) High-level expression and secretion of Bacillus pumilus lipase B26 in Bacillus subtilis chungkookjang. J. Microbiol. Biotechnol. 13: 892-896.
20. Sadaie, Y. and T. Kada (1983) Formation of competent Bacillus subtilis cells. J. Bacteriol. 153: 813-821.
21. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227: 680-685.
22. Damron, B. L (1998) Sodium chloride concentration in drinking water and eggshell quality. Poultry Science. 77: 1488-1491.
23. Pourreza, J., N. Nili, and M.A. Edriss (2000) Effect of saline drinking water on egg shell quality of leghorn and native hens J. Agr. Sci. Tech. 2: 3-8.
24. National Research Council (1994) Nutrient requirements of poultry (9th Ed). National academy press Washington DC USA.
25. Erdman, J. J. (1979) Oilseed phytates: nutritional implications. J Am Oil Chem Soc. 56:736-741.
26. Davis, P. N. L. C. Norris, and F. H. Kratzer (1968) Iron bioavail-ability in calcium and phosphorus sources. J Anim Sci 67(Suppl.1): 253 (Abstr.)
27. Bhattacharya, R. K. and G. C. Esh (1964) Metabolic relationship between dietary proteinand iron. III. Influence of protein and its breakdown products on iron absorption in partially iron depleted rats. Indian J. Biochem 1:142-146.
28. Shin, Y. M., T. H. Kwon, K. S. Kim, K. S. Chae, D. H. Kim, J. H. Kim, and M. S. Yang (2001) Enhanced iron uptake of Saccharomyces cerevisiae by heterologous expression of a tadpole ferritin gene. Appl. Environ. Microbiol. 67:1280-1283.