The Korean Society For Biotechnology And Bioengineering

Current Issues

Korean Society for Biotechnology and Bioengineering Journal - Vol. 35 , No. 1

[ Review Paper ]
Korean Society for Biotechnology and Bioengineering Journal - Vol. 35, No. 1, pp.23-33
Abbreviation: KSBB J
ISSN: 1225-7117 (Print) 2288-8268 (Online)
Print publication date 31 Mar 2020
Received 19 Dec 2019 Accepted 21 Jan 2020
DOI: https://doi.org/10.7841/ksbbj.2020.35.1.23

발효식품의 품질을 저해하는 부패효모의 발생원인과 검출 및 제어방법
정덕열 ; 박희영 ; 배은영 ; 설민경 ; 주예빈 ; 김종석 ; 장병관 ; Sultanov Akhmadjon ; 김병오 ; 조영제 ; 김수린*
경북대학교 식품공학부

Source of Contamination, Detection Techniques, and Control Methods of Spoilage Yeast in Fermented Foods
Deokyeol Jeong ; Heeyoung Park ; Eun-Yeong Bae ; Min-Kyeong Seol ; Ye-Bin Ju ; Jong-Seok Kim ; Byeong-Kwan Jang ; Sultanov Akhmadjon ; Byung-Oh Kim ; Young-Je Cho ; Soo Rin Kim*
School of Food Science and Biotechnology, Kyungpook National University, Daegu 41566, Korea
Correspondence to : School of Food Science and Biotechnology, Kyungpook National University, Daegu 41566, Korea Tel: +82-53-950-7769, Fax: +82-53-950-7762 e-mail: soorinkim@knu.ac.kr


© 2020 The Korean Society for Biotechnology and Bioengineering

Abstract

It is not commonly recognized that yeast is responsible for food spoilage as well as food fermentation. Fermented beverages and foods have several factors that inhibit bacterial growth such as high contents of organic acids, sugars, salts, and/or alcohol; however, some yeast species can tolerate these stress factors and cause food spoilage. Specifically, during wine and beer fermentation, if some contaminated spoilage yeast species grow dominantly over fermentation starter yeast, the products would have undesirable flavor. More importantly, during storage of fermented kimchi and soy sauce, some spoilage yeast species slowly grow on the surface of the products and produce gases, which limits product shelf life and exportability. In this review, spoilage yeast species commonly found in fermented foods are introduced. Next, contamination routes, detection methods, and control methods of the spoilage yeast will be described.


Keywords: film-forming yeast, molecular detection, food additives, packaging, biological control

1. INTRODUCTION

식품에서 부패를 일으키거나 식중독의 원인이 되는 미생물은 주로 세균류 (bacteria)이다. 예를 들어 우유 부패의 가장 주요한 원인균 중에 하나는 유당을 대사 할 수 있는 유산균 (lactic acid bacteria)이고, 우유 살균 시 열처리를 통한 사멸 목표 미생물은 Coxiella burnetii라는 Q열을 일으키는 내열성 병원성 세균이다 [1]. 이러한 부패 및 병원성 세균의 식품 오염 빈도 및 오염 원인 등에 대해서는 아주 광범위하게 연구가 되어왔고, 이를 검출 및 제어하기 위한 첨단 기술 또한 무수히 개발되고 있다 [2-4]. 그에 반해 효모류 (yeast)가 일부 식품군에서 주요한 부패 원인 미생물이라는 사실은 잘 알려져 있지 않으며 이를 제어하기 위한 기술도 아직 기초 단계이다 [5].

부패를 일으키는 효모류는 치즈 또는 김치, 맥주, 와인과 같은 발효식품에서 주로 발견된다. 식품의 발효 과정 중에는 다양한 유기산이 생성되어 발효식품의 pH를 낮춤으로써 부패세균의 생육을 억제할 수 있으며 [6], 발효주의 경우 fermentation starter효모의 발효를 통해 생성된 알코올이 부패세균의 생육을 효과적으로 억제한다. 이를통해 발효식품과 발효주는 열처리 또는 저온 보관 없이도 높은 저장 안정성을 가지게 된다 [7]. 하지만 Pichia manshurica 와 같은 일부 부패효모의 경우 낮은 pH에 내성을 가지고 있어 발효식품에서 생육하여 발효식품의 품질을 저하 [8]시키거나 발효주 제조 과정 중에 원료 등으로부터 오염된 일부 알코올에 내성을 가지는 부패효모는 발효주의 향미에 부정적인 영향을 미치는 성분을 생성하여 발효주의 품질을 저하시킨다 [9].

따라서, 발효식품 및 발효주는 유기산 및 알코올 함량이 높아 부패세균의 오염은 일반적으로 발생하지 않지만, 특정 환경에 내성을 가지는 일부 부패효모가 발효 과정 뿐만 아니라 보관 및 유통과정 중에 생육하여 제품 품질에 부정적인 영향을 줌으로써 결국 식품 산업 전체적으로 손실을 가져오게 하는 원인이 된다.

예를 들어 김치의 발효 과정 중에서 부패효모가 산막을 형성하면 이취 및 조직의 연부 현상을 일으켜 품질을 저하시키고, 이러한 산막 형성은 외관상으로도 문제가 된다 [10]. 또한 간장에서도 부패효모에 의해 산막이 형성될 수 있고 가스를 형성하여 용기를 팽창시킴으로써 품질에 문제가 생긴다 [11]. 이 외에도 와인과 맥주, 치즈 등 발효식품 및 발효주의 발효 과정에서 부패효모로 인한 다양한 품질 저하 문제가 생길 수 있다. 그러나 기존에는 이러한 부패효모에 관한 인식이 높지 않았으며, 따라서 관련 연구 동향도 미미한 수준이다 [12,13].

본 총설에서는 주요한 전통발효식품 및 다양한 발효식품에서 문제가 되는 부패효모의 사례를 살펴봄으로써 부패효모 제어의 산업적 중요성을 강조하고자 한다. 또한 발효식품 중 부패효모의 오염경로, 검출방법, 제어방법 등에 대해 논의해보겠다.


2. 발효식품 종류별 부패효모 발생 현황

김치, 간장과 같은 발효식품의 제조 공정에서는 발효에 기여하는 유용한 미생물이 우세하게 생육하더라도, 발효식품을 포장하여 저장 또는 유통하는 과정에서 부패효모가 발생할 수 있다. 이러한 부패효모의 특징 및 종류는 발효식품에 따라 상이하며, 어떤 발효식품에서는 종균 (starter culture)으로 쓰이는 균주가 다른 발효식품에서는 부패효모로 작용할 수도 있다. 따라서 발효 식품별로 어떠한 부패효모가 발생할 수 있는지 소개하고자 한다 (Fig. 1, Table 1). 기존에 발표된 많은 논문들에서 특히 와인 발효 과정 중에 발생할 수 있는 부패효모에 대해 광범위하게 소개하고 있기 때문에 [3,14-18], 본 글에서는 한국의 발효식품이면서 부패효모가 산업적으로 문제가 되는 김치 및 간장에 발생하는 부패효모에 대해 집중적으로 살펴보도록 하겠다.


Fig. 1. 
Yeast species and symptoms of spoilage in fermented foods.

Table 1. 
Spoilage yeast species in various fermented foods and beverages
Fermented foods
and beverages
Spoilage yeast species Symptoms of spoilage References
Wine Brettanomyces bruxellensis
Zygosaccharomyces bailii
Saccharomycodes ludwigii
Pichia guilliermondii
Pichia anomala
Candida tropicalis
- Production of gas, acetic acid and phenolic off-flavors
- Fermentation attenuation
- Formation of biofilm
- Cloudiness
[3, 14, 15]
Beer Brettanomyces bruxellensis
Brettanomyces anomalus
- Production of gas, acetic acid and phenolic off-flavors
- Low alcohol content and elevated pH
- Formation of biofilm
- Cloudiness
[3]
Yogurt Kluveromyces fragilis
Torulopsis candida
Meyerozyma guilliermondii
- Formation of bubbles [3, 6]
Kefir Saccharomyces cerevisiae
Kluyveromyces marxianus
- Formation of ethanol
- Off-flavour
[17]
Cheese Debaryomyces hansenii.
Yarrowia lipolytica.
- Fruity and bitter or yeasty off-flavors
- Change in the texture gassiness and softening
- Pigmentation or discoloration
[3, 18]

2.1. 김치

우리나라 대표 전통 발효식품인 김치는 다양한 종류의 원료로부터 유래하는 약 200여종의 미생물들의 복합 발효식품으로, 높은 저장안정성의 가장 주요한 메커니즘은 유산균이 생성하는 젖산 등의 유기산이 부패미생물의 생육을 억제하는 것이다 [6]. 그러나 김치 발효 후반부에는 이러한 유산균이 급격히 감소하면서 유기산을 대사하여 생장하는 부패효모가 생육할 수 있으며, 이는 산막 또는 골마지라고 부르는 김치 표면의 흰색 막의 원인이 된다 [19]. 이러한 부패효모 (산막효모)의 생육을 통해 형성된 김치 표면의 흰색 막은 김치의 외관을 손상시킬 뿐만 아니라 젖산을 비롯한 유기산이 분해되면서 퀴퀴한 냄새 성분을 생성하여 김치 맛이 저하되고, 김치 조직의 연부현상을 일으킨다 [20]. 더욱이 골마지의 형성이 김치의 환경을 변화시킴으로써 다른 종류의 부패세균 등의 생육을 촉진하는 원인이 될 수 있다 [19].

김치 골마지는 주로 인체에 독성이 없는 Hanseniaspora uvarum, Pichia kluyveri, Yarrowia lipolytica, Kazachstania servazzii, Candida sake 등의 효모에 의해 형성된다 [21]. 구체적으로는 김치 원료로부터 유입된 부패효모의 수가 발효 초기와 중기에 이르기까지 유지되는 경향을 보이다가, 발효 후기 유산균이 감소하는 시점 이후부터 점진적으로 증가한다. 예를 들면, Saccharomyces spp.는 유산균에 의한 발효가 끝나는 후기부터 20일 동안 증가하고 이후부터는 감소하기 시작하는데, 이때 ethanol과 glycerol을 생성하고 김치의 포도당과 과당의 농도를 감소시킨다. 반면에 Candida sp.는 발효가 끝나는 후기부터 45일 이후에 증식하여 김치 산패의 원인이 된다. 한편, Kazachstania exiguaKazachstania pseudohumilis, Pichia kudriavzevii와 같은 김치 부패효모 또한 김치 발효가 끝나는 후기부터 생육이 시작되는 것으로 알려져 있다 [19].

2.2. 간장

간장은 곰팡이, 효모, 유산균 등이 단계적으로 작용하여 대두를 분해 및 발효함으로써 생성되는 발효조미식품으로, 20% 이상의 높은 소금 함량이 일반적인 부패세균의 번식을 억제할 수 있다. 그러나 간장의 장기간의 숙성 과정 동안 산패가 일어나 이취가 발생할 수 있는데, 이는 김치와 유사하게 간장 표면에 형성되는 내염성 산막효모 때문이다 [22]. 간장에 번식하는 산막효모로는 Zygosaccharomyces rouxiiPichia anomala와 같은 내염성 효모가 있는데, 이 효모들은 주로 간장의 표면에 산막을 형성하여 제품의 시각적 품질은 물론 이취를 생산하여 제품의 가치를 떨어뜨린다 [23]. 또한 산막은 산소 공급의 차단으로 인해 발효미생물의 군집 특성을 변화시키며 산막의 자가 소화 분해로 여러 부패 균들의 증식을 유발한다 [24]. 한편, 비산막효모인 Candida globosa는 간장에 가스를 발생시켜 포장된 용기를 팽창시키며, 심한 경우에는 용기의 폭발을 일으킴으로써 제품의 가치를 떨어뜨릴 수 있다 [22].


3. 발효식품 중 부패효모의 오염 경로

부패효모에 의한 오염은 에탄올 내성과 같은 특징을 가진 부패효모가 직접적인 오염원으로 작용하여 위해 요인이 될 수 있고, 또한 효모의 대사과정에 의해 극한 생육 조건 (낮은 pH, 고농도의 당 등)이 완화됨으로써 다른 미생물의 오염을 야기할 수 있다. 이를 크게 발효 중에 일어날 수 있는 문제와 발효 후 과정에서 일어날 수 있는 문제로 나누어 부패효모의 오염 원인 및 경로에 대해 알아보고자 한다 (Fig. 2).


Fig. 2. 
Spoilage yeast contamination during the production of craft beer.

3.1. 비정상적인 발효

발효 과정 중에 나타나는 부패효모의 오염 원인으로는 원재료, 발효 장비, 온습도 및 세척수 등과 같은 외부적인 요인과 저산내성, 고삼투압성, 저온내성과 같은 부패효모의 특징에 따른 내부적인 요인으로 나눌 수 있다.

외부적 요인으로 인한 맥주 발효에서의 부패효모의 오염은 원료로 사용되는 곡물이나 홉을 세척 및 보관하는 과정에서 미생물이 증식할 수 있고, 발효 탱크나 이송라인 등이 세척수에 의한 간접적인 영향으로 교차 오염 될 수 있다. 비정상적인 상태로 발효가 진행될 경우, 발효조 표면에 남아 있던 미생물이 적합한 생육 환경이 조성되어 빠르게 증식함으로써 비정상적인 발효를 야기할 수 있다. 특히 봄 · 여름과 같은 온도 및 습도가 높은 계절에는 공기 중 혹은 공장 바닥이나 장비 세척 후 남아있는 수분에 의해서도 부패를 야기하는 미생물이 증식할 수 있다 [25, 26].

발효 과정 중의 부패효모 오염의 내부적인 요인은 다음과 같다. 산소가 거의 존재하지 않는 에탄올 발효에서는 대부분의 미생물의 생육이 저해 받는 반면, 에탄올에 내성을 가지며 비호기적인 조건에서도 생육 가능한 Brettanomyces sp. 부패효모는 와인이나 맥주 발효 과정 중에 증식하여 hydroxycinnamic acid와 같은 산을 생성함으로써 이취를 발생시킨다 [3]. 또한 과일이나 채소의 발효 결과로 생성되는 lactic acid 및 acetic acid와 같은 유기산에 의한 낮은 pH는 다른 부패 미생물이 생육하는데 큰 장벽이 될 수 있지만 P. manshuricaIssatchenkia occidentalis 같은 낮은 산에 내성이 있는 효모는 이러한 유기산들을 이용함으로써 발효액의 pH를 증가시키는 역할을 하기도 한다 [27]. Zygosaccharomyces bailii, Z. rouxii, Zygosaccharomyces lentus 와 같은 균주는 높은 당농도에서도 잘 생육하는 대표적인 내삼투성 효모로 꿀, 시럽, 농축된 과일 주스 등에 오염될 수 있다. 따라서 고농도의 당을 대사함으로써 다른 부패효모의 오염을 용이하게 하는 역할을 하기도 한다 [28].

3.2. 발효 후 문제

발효가 정상적으로 이루어진 후에도 숙성, 저장, 보관, 유통과정 중 여러가지 문제로 부패효모가 증식할 수 있다. 특히 와인 맥주와 같은 발효음료에서는 대부분의 미생물의 에탄올에 의해 생육이 억제되지만 Brettanomyces bruxellensis 와 같은 일부 부패효모는 에탄올에 대한 내성이 높아서 에탄올 발효 과정에서도 생육할 뿐만 아니라 와인 숙성 과정에서도 증식하며 휘발성 페놀 물질 등과 같은 이취의 원인이 된다[29, 30]. 이와같은 발효 후 부패효모 문제는 주로 부적절한 산소 차단 및 첨가물 사용에 의해 증폭된다.

예를들면, 미세산소기술(micro-oxygenation)은 와인 발효 후에 풍미를 증진시키기 위해 산소를 첨가하는 공정으로 와인 색을 더 진하게 만들고 맛을 부드럽게 만든다는 장점이 있지만, 산소공급으로 인해 부패효모의 증식의 원인이 될 수 있다 [31]. 또한 부패효모의 생육을 억제하기 위한 첨가물 사용이 충분하지 않을 경우, 보존제에 대한 내성이 매우 높은 Z. bailii과 같은 부패효모가 와인 숙성 및 저장과정에서 생육할 수 있다 [32].

추가적으로 일부 부패효모의 경우 β-glucosidase, lipolytic esterase 혹은 pectinase와 같은 분해효소를 세포 밖으로 분비하여 식품에 존재하는 cellulose, hemicellulose, pectin등의 고분자 물질을 다른 부패세균들이 쉽게 이용할 수 있는 탄소원 (glucose, xylose 및 galactose 등)으로 분해하는 등 생육 가능한 환경을 제공함으로써 포장된 제품의 팽창, 이취 생성, 혼탁 등의 품질 저하 원인을 제공한다 [33].


4. 검출방법
4.1. 선택-분별배지를 이용한 배양 방법

효모의 분리 및 정량분석을 위한 영양배지는 일반 배지와 동일하게 탄소원, 질소원, 무기염류. 비타민 등으로 구성되어 있다. 각각의 영양성분들은 포도당 및 과당, 자당 등을 통해 탄소원을 공급하며, 펩톤 및 트립톤, 카시톤, 효모추출물, 맥아추출물 등을 이용하여 질소원 및 무기염류, 비타민 등을 공급한다. 이러한 영양배지에서는 일반적으로 부패효모에 비해 발효효모가 빠르게 자라기 때문에 부패효모의 생육이 억제될 수 있다 [34]. 따라서, 영양배지를 대신하여 발효효모의 성장을 억제하고 부패효모의 성장을 촉진시킬 수 있는 선택배지 (selective medium) 또는 분별배지 (differential medium)가 필요하다.

부패효모는 일반적으로 발효효모에 비해 다양한 스트레스에 내성이 높기 때문에 부패효모의 선택배지를 개발할 때 이러한 원리를 적용할 수 있다. 이에 따라, 에탄올 및 방부제에 내성이 있는 부패효모의 정성, 정량 분석을 위한 선택배지가 개발되어왔다 [35]. 예를 들어, Brettanomyces differential medium (DBDM)은 탄소원으로 에탄올을 사용하고 cycloheximide에 내성을 지니기 때문에 와인 유래 B. bruxellensis 검출에 높은 효율을 보인다 [36]. Z. bailii selective medium (ZBA) 배지는 주로 아세트산과 소르빈산의 첨가로 인해 형성된 산성 조건에서 Z. bailii를 검출하는데 효과적인 것으로 밝혀졌다. 그러나 산성 식품 또는 산성 음료에서 아세트산을 첨가한 다른 배지보다 효율이 낮다는 단점이 있다 [38]. Brettanomyces specific medium (BSM)은 cycloheximide와 glucose를 포함하며 Brettanomyces spp.를 검출하는데 상용화된 배지다. 그러나 포도당을 선호하는 효모인 K. apiculateCandida tropicalis, Pichia guilliermondii가 빠른 성장을 보여 정확한 검출이 어렵다 [39].

이러한 종류의 선택배지는 효모 세포에 대한 스트레스 유도로 인해 영양배지보다 더 긴 배양 기간을 필요로 하는 단점이 있다 [35]. 반면에, 분별배지는 다당류, 단백질, 펙틴 및 지질과 같은 특정 중합체를 가수 분해하는 효모의 능력에 기초하므로 선택배지보다 배양 기간이 짧지만 [40], 개발된 사례는 아직 제한적이다 (Table 2)[2, 3, 36, 38, 39].

Table 2. 
Differential media for detection of spoilage yeast
Medium Target Strain Characteristic Food References
YLM Yarrowia lipolytica - Brown discoloration of medium containing tyrosine Cheese [2]
KDM Kluyveromyces marxianus
Kluyveromyces lactis
- Blue colony indicating the presence of β-galactosidase in
the absence of lactose
- Medium color changing from green to blue
Dairy product [39]
ZBA Zygosaccharomyces spp.
Acid tolerant yeasts
- Growth of organic acid tolerant yeast
- Poorer selectivity
Wine [38]
ZDM Zygosaccharomyces bailii - Blue colony growing on glucose and formic acid Wine [38]
DBDM Brettanomyces spp. - Colony color changing from yellow to green
- Phenolic odor
- Slow growth
- Medium color changing from blue to yellow.
Wine carbonated
drink
Soft drink
[3, 36, 38]

4.2. Microscopy

효모는 타원체 모양인 출아효모 (budding yeast)와 원통형 막대 모양인 분열효모 (fission yeast)로 나뉜다. 출아효모와 분열효모의 세포 증식 방식은 다르지만 기본적으로 세포 구조는 동일하다 [41]. 이들 효모는 두꺼운 세포벽을 갖고 있기 때문에 고정제와 세포벽 분해 효소를 이용하여 electron microscopy (EM)을 통해 관찰되어진다 [42]. 그러나 현미경을 통한 효모의 관찰은 형태, 세포 크기가 균주마다 다르고 성장, 배양배지, 환경적 스트레스에 따라 다양한 형태를 나타내기 때문에 감별이 쉽지 않다. 대체적으로 Brettanomyces sp.는 보트모양이지만 길쭉한 구형, 타원형 및 원통형 세포도 관찰되고 있다. 또한, 분지형 세포형태인 pseudohyphal 구조도 관찰되지만 Saccharomyces cerevisiae에서도 보고되는 형태로 Brettanomyces sp.에 특이적인 것은 아니다 [43, 44].

일반적인 현미경 관찰 방법을 통한 형태학적 분별의 어려움을 해결하기 위해 target sequence에 특이적으로 결합하는 PNA probe를 사용한 광학현미경 기술이 개발되었다. PNA probe는 pseudo peptide로 높은 특이성과 친화성, 빠른 반응 속도를 지녀 rRNA와 같은 고도로 구조화된 표적과 혼성화를 이루는 합성물질이다. 이 탐침자(probe)에 형광물질(fluorescein)을 표지 시켜 Brettanomyces sp.와 배양하면 종 특이적 염기서열과 결합하여 광학현미경을 통해 Brettanomyces sp.를 보다 빠르고 정확하게 식별할 수 있다 [39].

4.3. Molecular detection

발효식품 내 부패효모는 선택배지 또는 현미경을 이용하여 쉽게 검출할 수 있는 반면, 부패효모의 존재 여부를 확인하는데 많은 시간이 소요되며 정확한 종을 알 수 없을 뿐만 아니라 식품의 발효 초기 단계와 같이 적은 양이 존재할 경우 검출하는 데 한계가 있다는 단점을 가지고 있다. 따라서 중합효소연쇄반응 (PCR, Polymerase Chain Reaction)기술을 통해 부패효모의 리보솜 RNA (rRNA, ribosomal RNA) 염기서열을 분석하여 이러한 단점을 해결해 줄 수 있는 방법으로 제시되었다. 이러한 rRNA sequencing 분석은 부패효모가 소량 존재하더라도 단기간 내에 검출할 뿐만 아니라 동정까지 가능하다는 장점을 가지고 있다. 여기서 rRNA 유전자는 모든 미생물에 존재하고 있으며 미생물에 따라 유전자 염기서열이 상이하기 때문에 특정 미생물로 동정 할 수 있다.

rRNA는 단백질 합성에 관여하는 역할을 가지고 있으며, 리보솜의 소단위체의 구성에 따라 prokaryote 과 eukaryote을 구별할 수 있다. Prokaryote은 16S subunit을 가지고 있는 것이 특징이며, 일반적으로 세균 동정을 위해 16S rRNA를 분석한다. 반면에, 효모와 같이 eukaryote의 경우는 18S 및 5.8S, 25-28S subunits으로 구성되어 있으며, 주로 18S와 26S 사이의 DNA 영역인 ITS (Internal transcribed spacer)를 분석하여 동정이 이루어진다 [45]. ITS는 18S나 26S에 비해 진화적으로 유사한 생물 종간의 계통 관계를 분석하는데 유용하기 때문에 이러한 부분을 증폭할 수 있는 primer를 이용하여 진핵생물에서 유사 생물 종간의 계통 분류를 위한 지표로써 사용할 수 있으며 (Fig. 3, Table 3), 이러한 염기서열의 차이로 종의 분류와 식별이 가능하다 [10, 46-48]. rRNA sequencing 방법을 기반으로 와인 및 김치, 비알콜성 음료, 요구르트 등 다양한 식품 분야에서 쉽게 부패효모를 검출할 수 있으며 특히 양조 산업에서 주로 발생하는 부패효모인 Brettanomyces sp. 는 ITS1 또는 ITS4 primer를 이용하여 검출할 수 있다 [10, 46-48].


Fig. 3. 
The rRNA region and primers used for the identification of spoilage yeast. Primer information is specified in Table 3.

Table 3. 
Representative primers used for PCR-based detection and identification of spoilage yeast
Target Species Primer Sequences (5’-) References
26S rRNA Brettanomyces anomalus,
Brettanomyces bruxellensis
DB90F
DB394R
GAYACTAGAGAGAGRRGGARGGCACG
AGGAACGGGCCGCT
[46]
Candida sake,
Geotrichum fragrans,
Kazachstania exigua,
Kazachstania pseudohumilis,
Pichia fermentans,
Rhodotorula mucilaginosa,
Saccharomyces cerevisiae,
Torulaspora delbrueckii,
Trichosporon sp.
NL-1
NL-4
GCATATCAATAAGCGGAGGAAAAG
GGTCCGTGTTTCAAGACGG
[10, 47]
Partial ITS elements Brettanomyces sp. ITS1
ITS4
TCCGTAGGTGAACCTGCGG
TCCTCCGCTTATTGATATGC
[46]
18S rRNA Kluyveromyces marxianus 18SBdir
18SDinv
GCGATAACGAACGAGACCTTAA
TTGAGCCATAATTGGTCT
[48]

4.4. 기체 크로마토그래피-질량분석법

기체 크로마토그래피-질량분석법 (GC-MS)는 식품의 품질 관리 및 성분 분석의 다양한 측면에서 사용되는 감도가 높은 분석 방법이다. 이를 이용한 부패효모의 검출은 전통적으로 사용되는 집락 계수법에 비해 더 정확하고 특이적이며, 미생물을 분리하여 배양하는 과정을 필요로 하지 않기 때문에 신속한 분석이 가능하다는 장점이 있다. 또한 PCR과 같은 미생물의 유전적 염기서열을 이용한 미생물 동정 방법은 미생물의 분리 및 배양 시간을 필요로 하고 생균과 사균을 구별하기 어려우며 시간 및 비용이 많이 든다는 측면이 있지만, GC-MS는 이러한 단점들을 보완할 수 있어 부패 미생물을 검출하기 위한 대체 방법으로 떠오르고 있다 [49].

GC-MS를 통해 부패효모가 식품에 오염 되었는지의 여부를 판단하는 방법은 크게 두가지로 나뉠 수 있는데 첫 번째는 오염 효모의 대사체를 직접적으로 분석하는 방법이고 두 번째로는 효모가 생산하는 대사물질을 통해 오염여부를 판단하는 방법이다. 첫번째 방법으로, 주어진 균주의 질량스펙트럼을 이용하여 이와 연관된 단백질을 검출함으로써 미생물 동정이 가능하다는 연구결과가 보고되어 있지만, 부패효모의 직접적인 검출 방법은 신뢰 가능한 결과를 얻기 위해서는 상당한 양의 단백질이 필요하고 민감도가 낮다는 단점이 있다 [50].

따라서 미생물 대사체의 직접적인 분석 외에도 부패효모의 오염으로 인해 생긴 대사물질이 향기 성분과 같은 관능적 특성 및 품질에 영향을 미칠 수 있기 때문에, 식품의 휘발성유기 화합물 속에 포함되어 있는 다양한 종류의 펩티드를 분석하여 부패 미생물이 생성하는 이취 성분을 검출함으로써 식품의 오염여부를 신속하게 판단 할 수 있다 [51]. 또한 고체상 미세 추출 및 GC-MS 방법을 통해 일반적인 식품 보존제에 저항성이 있는 Candida metapsilosisZ. bailii 와 같은 균주를 87.5%의 성공률로 분류 및 정량하였다는 연구결과가 보고되었으며, 와인 발효 중 이취성분인 p-coumaric acid 및 4-ethylphenol의 함량의 변화를 통해 B. bruxellensis 뿐만 아니라 포도 또는 초파리, 기계 등 외적 요인으로부터 오염된 P. guilliermondii와 같은 부패효모의 존재 가능성을 제시할 수 있다 [37]. 이렇게 미생물의 휘발성 화합물 분석으로부터 얻은 크로마토그램을 이용하여 미생물의 활성, 양, 군집의 구조, 생리적활성에 대한 정보를 알 수 있다 [52].


5. 발효식품 중 부패효모의 제어 방법
5.1. 첨가물을 통한 부패효모 제어방법

일반적인 식품에서 미생물에 의한 부패를 방지하기 위해 식품 생산과정의 pH 및 온도를 조절하거나 단순한 여과 과정 또는 항미생물제를 첨가하여 부패효모뿐만 아니라 모든 미생물의 생육을 제어하는 방법을 주로 이용하였다. 하지만, 발효식품은 종균에 의해 원재료가 발효되어 만들어지는 식품 형태이기 때문에 부패효모만을 선택적으로 제어 해야하고, 이를 위해 다양한 식품첨가물이 활용되어왔다.

우선 이산화황 (SO2)의 첨가는 부패효모를 억제하기 위한 효과적이고 저렴한 방법으로 와인 제조에 가장 일반적으로 이용되고 있다. 이산화황은 단순 확산 작용을 통해 미생물 세포 내로 쉽게 침투하여 중성의 pH (pH 6.5)에서 중아황산 이온 (HSO3-)으로 전환이 이루어지게 되는데 [53], 이때 HSO3-가 세포 내에 축적될 경우 효소 반응이나 보조효소 (coenzyme), 보조인자 (co-factor), 핵산 등과 반응하여 세포의 생육을 저해하게 된다 [53, 54]. 예를 들면, 와인에서 주로 문제가 되는 부패효모인 B. bruxellensis는 1 mg/L의 이산화황으로 생육을 저해시킬 수 있다 [55]. 하지만 이산화황의 첨가는 부패효모가 ‘살아있지만, 배양이 되지 않는 상태 (VBNC, a viable but not culturable)’ 상태로 존재하여 완전한 사멸을 초래하지는 않으며, 최근에는 이산화황의 알레르기를 유발 가능성 때문에 [56, 57] 이산화황의 사용을 지양하고 있는 추세이다. 이산화황을 대체하여 효과적으로 부패효모를 억제할 수 있는 첨가물에는 대표적으로 소르빈산과 dimethyl dicarbonate (DMDC)가 있다.

소르빈산은 부패효모의 생육을 억제할 수 있는 대표적인 식품 첨가물 중 하나이다. 소르빈산을 식품에 사용할 때는 일반적으로 유기산이나 에탄올과 혼합하여 사용하거나 소르빈산 칼륨과 같은 염 형태로 사용한다. 이러한 소르빈산은 친유성 형태를 가지는 약산성 물질 (pKa 4.76)로써 이산화황과 비슷한 매커니즘을 통해 이온화된 소르빈산이 세포내에 축적되어 부패효모의 생육을 저해하게 된다 [58]. 소르빈산은 일부 고농도 당에서 내성을 가지는 부패효모의 생육을 억제할 수는 없지만, 간장의 부패효모인 Z. rouxii의 생육을 억제시키는 용도로는 탁월한 효과를 가진다 [59]. 하지만, 소르빈산은 에탄올 내성이 높을수록 많은 양의 소르빈산을 필요로 하며 일부 고농도 당에서 내성을 가지는 부패효모의 경우 생육을 억제하지 못하기 때문에 특정 식품에 사용하기는 어려움이 따른다 [59].

세 번째로 DMDC는 와인 발효에 주로 이용하는 첨가물 중 하나로써 수용액 상태에서 빠르게 분해되고 인체에 유해하지 않으며, 부패효모만 특이적으로 사멸시킬 수 있다는 장점을 가지고 있다. 이전 연구에서는 레드 와인을 발효할 때 최대 200 mg/L DMDC를 첨가하면 종균인 S. cerevisiae의 에탄올 발효에는 영향을 미치지 않지만, Z. bailiiSaccharomycodes ludwigii와 같은 부패효모의 생육을 억제했으며 [60, 61], 이취를 발생시키는 황화합물을 감소시킨다는 보고 또한 있었다 [62]. 하지만 DMDC는 와인 발효의 원재료에 의해 영향을 받기 때문에 일부 와인 제조에서는 높은 양의 DMDC (400 mg/L)를 첨가해야 부패효모의 생육을 저해시키므로 비용·효율적인 측면을 고려해야 할 필요가 있다 [63].

최근 연구에서는 키토산 [64], 에센셜 오일 [65] 및 복합 효소액 [66]과 같이 동식물 또는 미생물 유래 복합성 고분자 물질을 활용하여 부패효모의 생육을 제어하는 다양한 방안이 모색되고 있다. 첫 번째로 키토산은 주로 갑각류에 존재하는 천연 고분자 물질로 키틴의 아세틸기가 제거된 형태로 존재한다 [64, 67]. 이러한 키토산은 미생물의 세포막에 결합하여 미생물의 생육을 억제하는 항미생물 효과를 가질 뿐만 아니라 인체에 무해하기 때문에 식품 첨가물로 이용되고 있는 물질이다 [64]. 예를 들어, 맥주나 와인 발효 과정에서 주로 발생하는 부패효모 B. bruxellensisZ. bailii 등은 0.2~0.4 g/L의 키토산에서 생육에 저해를 보이는 반면, 종균인 S. cerevisiae는 최대 2 g/L까지 내성을 가지기 때문에 적절한 양의 키토산을 첨가하여 부패효모만을 특이적으로 제어할 수 있다 [68, 69]. 하지만, 와인 제조시 키토산을 첨가하면 와인의 색을 연하게 만드는 단점을 가지기 때문에 제조하는 와인의 특성에 맞춰 사용 유무를 판단할 필요가 있다 [68]. 두 번째로 essential oil, eugenol, carvacrol, 및 allicin 과 같은 식물성 유래의 고분자 화합물 또한 부패효모의 생육을 저해 할 수 있다 [18, 65]. 이러한 식물성 유래의 고분자 화합물들은 세포의 pH를 변화시키거나 활성산소의 농도 증가, 세포벽이나 효소 등과 결합하여 세포의 생육 패턴을 불안정화 시키는 등의 작용을 통해 부패효모의 생육을 저해할 수 있다 [70, 71]. 마지막으로 발효식품에 세포막을 분해하는 복합효소액을 첨가하여 부패효모를 사멸시킬 수 있다. 세포막 분해효소액은 endo-β(1-3)-glucanase 및 exo-β(1-3)-glucanase, exo-β(1-6)-glucanase, β-glucosidase 등 복합효소액으로 구성되어 있으며, 이전 연구에서는 알코올 발효에 시중에 판매하는 GlucanexTM (Novozymes, Dittingen, Switzerland)을 115~200 μg/mL 첨가할 경우 B. bruxellensisZ. bailii 와 같은 부패효모의 생육을 억제시킬 수 있다는 보고 또한 있었다 [66].

5.2. 포장방법 및 포장재의 개선을 통한 부패효모 제어방법

식품 포장에 있어서 포장재 내부의 산소는 식품의 품질에 직접적으로 관련 되어있다. 포장 내부로 산소가 유일 될 경우 식품의 지방 산화 [72] 및 호기성 부패효모의 성장이 촉진되며, 혐기적인 상태일 경우 혐기성 부패효모가 발생할 수 있다 [73]. 단순한 기체 조성의 조절을 통해 부패 미생물 및 부패효모의 제어를 위해서 주로 이용하는 방법은 가스 치환 포장 (Modified Atmosphere Packaging, MAP) 과 진공 포장 (Vacuum Packaging)이다 [74]. 가스 치환 포장 방법은 포장재 내부의 산소를 질소 및 이산화탄소 등의 비활성 기체로 치환하여 산소를 제거하는 방법이고, 진공포장 방법은 내부의 기체를 모두 제거하는 방법이다. 두 방법 모두 산소를 제거함으로써 식품에 부패 미생물이 존재하더라도 포장재 내부에서 생육할 수 없도록 하는 포장법이다 [74]. 하지만 발효식품의 경우 발효에 의해 자체적으로 이산화탄소 등의 기체를 생산하기 때문에 포장재 내부 기체 조성의 조절만으로는 부패효모의 생육을 제어하기 어렵다. 이러한 문제를 해결하기 위해 포장 내 가스 조절 방식에 항진균, 또는 탈산소제 등의 기능을 가지는 다양한 첨가제를 추가하는 활성 포장 (Active Packaging) 방식이 개발되었다. 이 방법은 포장된 식품을 직접적으로 제어함으로써 식품의 유통기한 및 영양적 가치를 보존할 수 있는 기술이다 [75, 76].

김치는 젖산균에 의해서 포장-운송 중에도 발효가 진행되어 지속적으로 이산화탄소를 생성한다. 이러한 특성 때문에, MAP나 진공 포장과 같은 포장 기술의 적용이 어려울 뿐 아니라 산소에 노출될 시에는 골마지라고 불리는 산막 형성 효모의 증식에 의하여 맛과 품질이 저해된다 [19]. 뿐만 아니라 산막 형성 효모는 증식하면서 김치의 pH를 상승시켜 또 다른 부패성 미생물의 증식을 촉진하기에 이러한 요소를 모두 제어할 수 있는 포장 기술의 개발이 중요하다 [77]. 기존에는 부패효모에 의한 김치의 변패를 막기위하여 MAP나 진공포장을 이용하여 산소와의 접촉을 차단하였지만, 잔류 산소의 선택적 투과의 어려움으로 인해 효과적인 제어가 어렵다 [78]. 이러한 문제를 해결하기 위해 아스코르브산을 비롯한 폴리 페놀류 등 다양한 소재를 이용하여 비금속류 탈산소제 [79] 또는 아황산 염 기반의 비금속 탈산소제 [80]를 개발하여 미생물을 효과적으로 억제할 수 있었다.

반면, 발효 생산물을 제품화한 발효 식품의 경우, 항진균 효과가 있는 첨가물을 주로 진공 포장과 함께 이용하거나 첨가물을 포장재와 혼합하여 사용함으로써 부패효모를 억제할 수 있다. 흔히 부패효모의 방지를 위해 소르빈산 및 벤조산, 이산화황과 같은 합성 첨가물을 많이 사용하였으나, 최근에는 천연 물질을 첨가한 활성 포장 방식 또한 개발되었다 [76]. 이전 연구에서는 약용 식물의 천연 에센셜 오일인 cinnamaldehyde가 코팅된 필름을 사용하여 Staphylococcus aureus 등 중온성 부패미생물과 효모, 균류에 대하여 5%의 함량으로도 대조군 대비 50% 이상의 항미생물 효과를 보였다 [81]. 또한 2~4% 식물 에센셜 오일이 첨가된 폴리프로필렌(PP) 필름 포장을 이용하여 간장에서 발생하는 부패효모인 Z. rouxii와 치즈의 부패효모인 B. hansenii의 생육을 저해하는 결과를 확인할 수 있었다 [82]. 현재 시중에 판매되고 있는 간장의 용기 재질은 대부분 폴리에틸렌 테레프탈레이트 (PET)를 이용하기 때문에 식물성 에센셜 오일과 PET 소재의 접목에대해 꾸준한 연구가 필요하다.

이 외에도 미생물이 생산하는 항진균 물질을 포장기법에 적용하여 부패효모를 억제할 수 있다. 이전 연구에서는 Streptomyces natalenis가 생산하는 항진균물질인 나타마이신 (natamycin)과 Streptococcus lactis가 생산하는 나이신(nisin)을 첨가한 가식성 필름을 치즈의 표면에 진공 흡착시킴으로써 치즈 가공에서 부패효모인 S. cerevisiae 를 99% 이상 감소시키는 효과를 보였다 [83].

이처럼 최근에는 기존에 사용되는 식품 첨가물인 소르빈산염 뿐만 아니라, 미생물이 생산하는 천연 항생제나 천연 허브에서 추출한 식물 유래의 에센셜 오일 등을 이용할 뿐만 아니라 포장 과정에 접목하여 시너지 효과를 나타내는 방법들이 고안되고 있다. 나아가 발달된 형태의 포장 기술과 함께 이용하여 효과적으로 다양한 부패 미생물의 생육을 제어할 수 있다.

5.3. 생물학적 부패효모 제어방법

발효식품에서 생육하는 유산균과 같은 유익균이 생산하는 다양한 유기산 및 항진균 물질들이 부패효모의 생육을 억제할 수 있다 [6]. 예를들면, 유산균이 생성하는 초산, 젖산, 프로피온산과 같은 유기산과, reuterin, cyclic dipeptides, 지방산, 카르복실산 등 다양한 대사산물들이 항진균 활성을 가진다 [84]. 물론 일반적인 부패효모들이 유기산 등에 내성을 가지고 있으나, 유기산 뿐만 아니라 다양한 항진균 물질이 유산균의 성공적인 발효를 통해 생성되어 복합적으로 작용한다면, 부패효모가 발생할 가능성이 매우 낮을 것이다 [85]. 구체적으로는 김치 골마지의원인이 되는 대표적인 부패효모 K. exigua, P. kudriavzevii [86, 87]에 대해 김치 유래 Lactobacillus plantarum HD1의 배양액이 효과적인 항진균 효과를 보였다 [84]. 따라서 유산균과 부패효모 간의 상호작용에 대한 심층적인 연구를 통해, 향후에는 부패효모를 효과적으로 억제하는 발효방법이나 유산균 유래 첨가물 등이 개발될 수 있을 것이다.


6. CONCLUSION

일반적인 식품 부패 미생물인 세균류 및 곰팡이류는 발효식품의 높은 유기산 및 에탄올 함량에 의해 생육에 저해를 받는 반면, 효모류는 이러한 환경에서 내성을 가지고 생육하여 발효식품의 부패를 일으킨다. 특히 해외에서는 와인 및 맥주 발효 중에 문제가 될 수 있는 부패효모에 대해서 체계적으로 연구가 되어 있는 반면, 우리나라 전통 발효식품인 김치 및 간장에서는 부패효모의 중요성이 간과되어 왔다. 부패효모는 일반적으로 인체에 독성이 없으나 발효식품의 관능적 품질을 저하시키고 포장에 변형을 일으킴으로써 제품의 유통 특히 수출 과정에서 산업적으로 큰 손실의 원인이 될 수 있다. 이러한 부패효모를 어떻게 검출하고 제어할 것인지에 대해 향후 많은 연구가 필요할 것이다.


REFERENCES
1. Neare, K., M. Janson, P. Hütt, B. Lassen, and A. Viltrop (2019) Coxiella burnetii antibody prevalence and risk factors of infection in the human population of estonia. Microorganisms. 7: 629.
2. Carreira, A., L. M. Ferreira, and V. Loureiro (2001) Brown pigments produced by Yarrowia lipolytica result from extracellular accumulation of homogentisic acid. Appl. Environ. Microbiol. 67: 3463-3468.
3. Hernández, A., F. Pérez-Nevado, S. Ruiz-Moyano, M. Serradilla, M. Villalobos, et al. (2018) Spoilage yeasts: What are the sources of contamination of foods and beverages? Int. J. Food Microbiol. 286: 98-110.
4. Park, C. R., S. J. Park, W. G. Lee, and B. H. Hwang (2018) Biosensors using hybridization chain reaction-design and signal amplification strategies of hybridization chain reaction. Biotechnol. Bioprocess Eng. 23: 355-370.
5. Lee, M. G., M. I. Khan, H. J. Seo, J. H. Shin, M. Y. Kim, et al. (2017) In vivo and In vitro antimicrobial effects of natural antibiotics present in crude extracts of various medicinal plants. KSBB Journal. 32: 22-28.
6. Gaenzle, M. G. (2015) Lactic metabolism revisited: metabolism of lactic acid bacteria in food fermentations and food spoilage. Curr. Opin. Food Sci. 2: 106-117.
7. Tamang, J. P., D.-H. Shin, S.-J. Jung, and S.-W. Chae (2016) Functional properties of microorganisms in fermented foods. Front. Microbiol. 7: 578.
8. Perpetuini, G., F. Tittarelli, M. Schirone, P. Di Gianvito, A. Corsetti, et al. (2018) Adhesion properties and surface hydrophobicity of Pichia manshurica strains isolated from organic wines. LWT. 87: 385-392.
9. Guzzon, R., R. Larcher, R. Guarcello, N. Francesca, L. Settanni, et al. (2018) Spoilage potential of Brettanomyces bruxellensis strains isolated from Italian wines. Food Res. Int. 105: 668-677.
10. Suzuki, A., N. Muraoka, M. Nakamura, Y. Yanagisawa, and S. Amachi (2018) Identification of undesirable white-colony-forming yeasts appeared on the surface of Japanese kimchi. Biosci., Biotechnol., Biochem. 82: 334-342.
11. Devanthi, P. V. P., and K. Gkatzionis (2019) Soy sauce fermentation: Microorganisms, aroma formation, and process modification. Food Res. Int. 120: 364-374.
12. Tubía, I., J. Paredes, E. Pérez-Lorenzo, and S. Arana (2018) Antibody biosensors for spoilage yeast detection based on impedance spectroscopy. Biosensors Bioelectron. 102: 432-438.
13. Lee, D., Y. Seo, M. S. Khan, J. Hwang, Y. Jo, et al. (2018) Use of nanoscale materials for the effective prevention and extermination of bacterial biofilms. Biotechnol. Bioprocess Eng. 23: 1-10.
14. Hutzler, M., R. Riedl, J. Koob, and F. Jacob (2012) Fermentation and spoilage yeasts and their relevance for the beverage industry-A review. BrewingScience-Monatsschrift Für Brauwissenschaft. 65: 33-50.
15. Escott, C., I. Loira, A. Morata, M. A. Bañuelos, and J. A. Suárez-Lepe (2017) Wine spoilage yeasts: Control strategy. Yeast-Industrial Applications; Morata, A., Loira, I., (eds.). 89-116.
16. Buehler, A., R. Evanowski, M. Wiedmann, and N. Martin (2019) Internal transcribed spacer (ITS) sequence-based characterization of fungal isolates from multiple yogurt facilities-A case study. J. Dairy Sci. 102: 3646-3653.
17. Altay, F., F. Karbancıoglu-Güler, C. Daskaya-Dikmen, and D. Heperkan (2013) A review on traditional Turkish fermented non-alcoholic beverages: microbiota, fermentation process and quality characteristics. Int. J. Food Microbiol. 167: 44-56.
18. Khorshidian, N., M. Yousefi, E. Khanniri, and A. M. Mortazavian (2018) Potential application of essential oils as antimicrobial preservatives in cheese. Innov. Food Sci. Emerg. Technol. 45: 62-72.
19. Kang, S. E., M. J. Kim, and T. W. Kim (2019) Diversity and role of yeast on kimchi fermentation. J. Korean Soc. Food Cult. 34: 201-207.
20. Kim, D.-M., and K.-H. Kim (2014) Growth of lactic acid bacteria and quality characteristics of baechu kimchi prepared with various salts and concentration. J. Korean Soc. Food Cult. 29: 286-297.
21. Kim, J. Y., J. Kim, I.-T. Cha, M. Y. Jung, H. S. Song, et al. (2019) Community structures and genomic features of undesirable white colony-forming yeasts on fermented vegetables. J. Microbiol. 57: 30-37.
22. Kim, Y. S., and K. H. Kyung (1997) Isolation and identification of yeasts occurred in inflated commercial soy sauce. Korean J. Food & Nutr. 10: 97-101.
23. Kim, Y.-S., K.-H. Kyung, and Y.-S. Kim (2000) Inhibition of soy sauce film yeasts by Allyl isothiocyanate and horse-radish powder. Korean J. Food & Nutr. 13: 263-268.
24. Jeon, S., M. Ryu, Y. S. Kim, S. W. Jo, D. Y. Jeong, et al. (2013) Isolation and identification of Bacillus strains with antagonistic properties against film-forming yeasts overgrown in low salted soybean pastes. Korean J. Microbiol. 49: 286-291.
25. Bokulich, N. A., J. Bergsveinson, B. Ziola, and D. A. Mills (2015) Mapping microbial ecosystems and spoilage-gene flow in breweries highlights patterns of contamination and resistance. Elife. 4: e04634.
26. Bokulich, N. A., J. H. Thorngate, P. M. Richardson, and D. A. Mills (2014) Microbial biogeography of wine grapes is conditioned by cultivar, vintage, and climate. Proc. Natl. Acad. Sci. 111: E139-E148.
27. Franco, W., and I. M. Pérez-Díaz (2013) Microbial interactions associated with secondary cucumber fermentation. J. Appl. Microbiol. 114: 161-172.
28. Wang, H., Z. Hu, F. Long, C. Guo, C. Niu, et al. (2016) Combined effect of sugar content and pH on the growth of a wild strain of Zygosaccharomyces rouxii and time for spoilage in concentrated apple juice. Food Control. 59: 298-305.
29. Renouf, V., and A. Lonvaud-Funel (2007) Development of an enrichment medium to detect Dekkera/Brettanomyces bruxellensis, a spoilage wine yeast, on the surface of grape berries. Microbiol. Res. 162: 154-167.
30. Renouf, V., M. Falcou, C. Miot-Sertier, M. C. Perello, G. De Revel, et al. (2006) Interactions between Brettanomyces bruxellensis and other yeast species during the initial stages of winemaking. J. Appl. Microbiol. 100: 1208-1219.
31. du Toit, W. J., K. Lisjak, J. Marais, and M. du Toit (2017) The effect of micro-oxygenation on the Phenolic Composition, Quality and Aerobic Wine-Spoilage Microorganisms of Different South African Red Wines. S. Afr. J. Enol. Vitic. 27: 11.
32. Ocón, E., A. R. Gutiérrez, P. Garijo, R. López, and P. Santamaría (2010) Presence of non-Saccharomyces yeasts in cellar equipment and grape juice during harvest time. Food Microbiol. 27: 1023-1027.
33. Arroyo-López, F., A. Querol, J. Bautista-Gallego, and A. Garrido Fernández (2008) Role of yeast in table olive production. Int. J. Food Microbiol. 128: 189-196.
34. Beuchat, L. R. (1993) Selective media for detecting and enumerating foodborne yeasts. Int J Food Microbiol. 19: 1-14.
35. Loureiro, V., and A. Querol (1999) The prevalence and control of spoilage yeasts in foods and beverages. Trends Food Sci. Technol. 10: 356-365.
36. Tubia, I., K. Prasad, E. Pérez-Lorenzo, C. Abadín, M. Zumárraga, et al. (2018) Beverage spoilage yeast detection methods and control technologies: A review of Brettanomyces. Int. J. Food Microbiol. 283: 65-76.
37. Zuehlke, J., B. Petrova, and C. Edwards (2013) Advances in the control of wine spoilage by Zygosaccharomyces and Dekkera/Brettanomyces. Annu. Rev. Food Sci. Technol. 4: 57-78.
38. Stender, H., C. Kurtzman, J. J. Hyldig-Nielsen, D. Sorensen, A. Broomer, et al. (2001) Identification of Dekkera bruxellensis (Brettanomyces) from wine by fluorescence in situ hybridization using peptide nucleic acid probes. Appl Environ Microbiol. 67: 938-941.
39. Fleet, G. (1992) Spoilage yeasts. Crit Rev Biotechnol. 12: 1-44.
40. Osumi, M. (2012) Visualization of yeast cells by electron microscopy. J. Electron Microsc. 61: 343-365.
41. Kitamura, K., T. Kaneko, and Y. Yamamoto (1971) Lysis of viable yeast cells by enzymes of Arthrobacter luteus. Arch Biochem Biophys. 145: 402-404.
42. Gancedo, J. M. (2001) Control of pseudohyphae formation in Saccharomyces cerevisiae. FEMS Microbiol. Rev. 25: 107-123.
43. Lo, W. S., E. I. Raitses, and A. M. Dranginis (1997) Development of pseudohyphae by embedded haploid and diploid yeast. Curr Genet. 32: 197-202.
44. Granneman, S., E. Petfalski, and D. Tollervey (2011) A cluster of ribosome synthesis factors regulate pre-rRNA folding and 5.8S rRNA maturation by the Rat1 exonuclease. The EMBO Journal. 30: 4006-4019.
45. Oelofse, A., A. Lonvaud-Funel, and M. du Toit (2009) Molecular identification of Brettanomyces bruxellensis strains isolated from red wines and volatile phenol production. Food Microbiol. 26: 377-385.
46. Cardoso, V. M., B. M. Borelli, C. A. Lara, M. A. Soares, C. Pataro, et al. (2015) The influence of seasons and ripening time on yeast communities of a traditional Brazilian cheese. Food Res. Int. 69: 331-340.
47. Mayoral, M. B., R. Martín, A. Sanz, P. E. Hernández, I. González, et al. (2005) Detection of Kluyveromyces marxianus and other spoilage yeasts in yoghurt using a PCR-culture technique. Int. J. Food Microbiol. 105: 27-34.
48. Andorrà, I., M. Berradre, A. Mas, B. Esteve-Zarzoso, and J. M. Guillamón (2012) Effect of mixed culture fermentations on yeast populations and aroma profile. LWT-Food Sci. Technol. 49: 8-13.
49. Taverna, C. G., M. Mazza, N. S. Bueno, C. Alvarez, S. Amigot, et al. (2018) Development and validation of an extended database for yeast identification by MALDI-TOF MS in Argentina. Med. Mycol. 57: 215-225.
50. Meersman, E., J. Steensels, N. Struyf, T. Paulus, V. Saels, et al. (2016) Tuning chocolate flavor through development of thermotolerant Saccharomyces cerevisiae starter cultures with increased acetate ester production. Appl. Environ. Microbiol. 82: 732-746.
51. Dias, L., S. Dias, T. Sancho, H. Stender, A. Querol, et al. (2003) Identification of yeasts isolated from wine-related environments and capable of producing 4-ethylphenol. Food Microbiol. 20: 567-574.
52. Arroyo-Manzanares, N., B. Markiv, J. Hernández, I. López-García, I. Guillén, et al. (2019) Head-space gas chromatography coupled to mass spectrometry for the assessment of the contamination of mayonnaise by yeasts. Food Chem. 289: 461-467.
53. STRATFORD, M., and A. H. ROSE (1986) Transport of sulphur dioxide by Saccharomyces cerevisiae. Microbiology. 132: 1-6.
54. Lisanti, M. T., G. Blaiotta, C. Nioi, and L. Moio (2019) Alternative Methods to SO2 for Microbiological Stabilization of Wine. Compr. Rev. Food. Sci. Food Saf. 18: 455-479.
55. Barata, A., J. Caldeira, R. Botelheiro, D. Pagliara, M. Malfeito-Ferreira, et al. (2008) Survival patterns of Dekkera bruxellensis in wines and inhibitory effect of sulphur dioxide. Int. J. Food Microbiol. 121: 201-207.
56. Santos, M. C., C. Nunes, J. A. Saraiva, and M. A. Coimbra (2012) Chemical and physical methodologies for the replacement/reduction of sulfur dioxide use during winemaking: review of their potentialities and limitations. Eur. Food Res. Technol. 234: 1-12.
57. Serpaggi, V., F. Remize, G. Recorbet, E. Gaudot-Dumas, A. Sequeira-Le Grand, et al. (2012) Characterization of the “viable but nonculturable”(VBNC) state in the wine spoilage yeast Brettanomyces. Food Microbiol. 30: 438-447.
58. WARTH, A. D. (1985) Resistance of yeast species to benzoic and sorbic acids and to sulfur dioxide. J. Food Prot. 48: 564-569.
59. Stratford, M., and P. Anslow (1998) Evidence that sorbic acid does not inhibit yeast as a classic ‘weak acid preservative’. Lett. Appl. Microbiol. 27: 203-206.
60. Costa, A., A. Barata, M. Malfeito-Ferreira, and V. Loureiro (2008) Evaluation of the inhibitory effect of dimethyl dicarbonate (DMDC) against wine microorganisms. Food Microbiol. 25: 422-427.
61. Zuehlke, J., D. Glawe, and C. Edwards (2015) Efficacy of dimethyl dicarbonate against yeasts associated with Washington State grapes and wines. J. Food Process. Preserv. 39: 1016-1026.
62. Threlfall, R., and J. Morris (2002) Using dimethyldicarbonate to minimize sulfur dioxide for prevention of fermentation from excessive yeast contamination in juice and semi-sweet wine. J. Food Sci. 67: 2758-2762.
63. Delfini, C., P. Gaia, R. Schellino, M. Strano, A. Pagliara, et al. (2002) Fermentability of grape must after inhibition with dimethyl dicarbonate (DMDC). J. Agric. Food Chem. 50: 5605-5611.
64. Brasselet, C., G. Pierre, P. Dubessay, M. Dols-Lafargue, J. Coulon, et al. (2019) Modification of Chitosan for the Generation of Functional Derivatives. Appl. Sci. 9: 1321.
65. Ribes, S., A. Fuentes, P. Talens, and J. M. Barat (2018) Prevention of fungal spoilage in food products using natural compounds: a review. Crit. Rev. Food Sci. Nutr. 58: 2002-2016.
66. Enrique, M., A. Ibáñez, J. Marcos, M. Yuste, M. Martinez, et al. (2010) β-Glucanases as a Tool for the Control of Wine Spoilage Yeasts. J. Food Sci. 75: M41-M45.
67. Hamed, I., F. Özogul, and J. M. Regenstein (2016) Industrial applications of crustacean by-products (chitin, chitosan, and chitooligosaccharides): A review. Trends Food Sci. Technol. 48: 40-50.
68. Ferreira, D., D. Moreira, E. M. Costa, S. Silva, M. M. Pintado, et al. (2013) The antimicrobial action of chitosan against the wine spoilage yeast Brettanomyces/Dekkera. J. Chitin Chitosan Sci. 1: 240-245.
69. Elmacı, S. B., G. Gülgör, M. Tokatlı, H. Erten, A. İşci, et al. (2015) Effectiveness of chitosan against wine-related microorganisms. Antonie Van Leeuwenhoek. 107: 675-686.
70. da Cruz Cabral, L., V. F. Pinto, and A. Patriarca (2013) Application of plant derived compounds to control fungal spoilage and mycotoxin production in foods. Int. J. Food Microbiol. 166: 1-14.
71. da Rocha Neto, A. C., M. Maraschin, and R. M. Di Piero (2015) Antifungal activity of salicylic acid against Penicillium expansum and its possible mechanisms of action. Int. J. Food Microbiol. 215: 64-70.
72. Labuza, T. P., and L. Dugan Jr (1971) Kinetics of lipid oxidation in foods. Crit. Rev. Food Sci. Nutr. 2: 355-405.
73. Fleet, G. H. (2011) Yeast spoilage of foods and beverages. pp.53-63.The yeasts.Elsevier.
74. Church, I. J., and A. L. Parsons (1995) Modified atmosphere packaging technology: a review. J. Sci. Food Agric. 67: 143-152.
75. Ozdemir, M., and J. D. Floros (2004) Active food packaging technologies. Crit. Rev. Food Sci. Nutr. 44: 185-193.
76. Nguyen Van Long, N., C. Joly, and P. Dantigny (2016) Active packaging with antifungal activities. Int. J. Food Microbiol. 220: 73-90.
77. Kim, J., J. Bang, L. R. Beuchat, H. Kim, and J.-H. Ryu (2012) Controlled fermentation of kimchi using naturally occurring antimicrobial agents. Food Microbiol. 32: 20-31.
78. Jeong, S., H.-G. Lee, J.-S. Lee, and S. Yoo (2019) Critical review on active technologies to regulate the levels of carbon dioxide and oxygen for kimchi packaging. J. Korean Soc. Food Cult. 34: 233-239.
79. Gaikwad, K. K., S. Singh, and Y. S. Lee (2018) Oxygen scavenging films in food packaging. Environ. Chem. Lett. 16: 523-538.
80. Lee, J. S., S. Jeong, H. G. Lee, C. H. Cho, and S. Yoo (2018) Development of a sulfite-based oxygen scavenger and its application in kimchi packaging to prevent oxygen-mediated deterioration of kimchi quality. J. Food Sci. 83: 3009-3018.
81. Lopes, F. A., N. de Fátima Ferreira Soares, C. de Cássia Pires Lopes, W. A. da Silva, J. C. B. Júnior, et al. (2014) Conservation of bakery products through cinnamaldehyde antimicrobial films. Packag. Technol. Sci. 27: 293-302.
82. Gutierrez, L., A. Escudero, R. Batlle, and C. Nerin (2009) Effect of mixed antimicrobial agents and flavors in active packaging films. J. Agric. Food Chem. 57: 8564-8571.
83. Resa, C. P. O., L. N. Gerschenson, and R. J. Jagus (2016) Starch edible film supporting natamycin and nisin for improving microbiological stability of refrigerated argentinian Port Salut cheese. Food Control. 59: 737-742.
84. Ryu, E. H., E. J. Yang, E. R. Woo, and H. C. Chang (2014) Purification and characterization of antifungal compounds from Lactobacillus plantarum HD1 isolated from kimchi. Food Microbiol. 41: 19-26.
85. Ross, R. P., S. Morgan, and C. Hill (2002) Preservation and fermentation: past, present and future. Int. J. Food Microbiol. 79: 3-16.
86. Loureiro, V., and M. Malfeito-Ferreira (2003) Spoilage yeasts in the wine industry. Int. J. Food Microbiol. 86: 23-50.
87. Moon, S. H., M. Chang, H. Y. Kim, and H. C. Chang (2014) Pichia kudriavzevii is the major yeast involved in film-formation, off-odor production, and texture-softening in over-ripened Kimchi. Food Sci. Biotechnol. 23: 489-497.