The Korean Society For Biotechnology And Bioengineering

Current Issues

Korean Society for Biotechnology and Bioengineering Journal - Vol. 35 , No. 2

[ Research Paper ]
Korean Society for Biotechnology and Bioengineering Journal - Vol. 35, No. 2, pp.129-134
Abbreviation: KSBB J
ISSN: 1225-7117 (Print) 2288-8268 (Online)
Print publication date 30 Jun 2020
Received 10 Feb 2020 Revised 06 Mar 2020 Accepted 07 Mar 2020
DOI: https://doi.org/10.7841/ksbbj.2020.35.2.129

Xylose 기질을 소모하는 재조합 Saccharomyces cerevisiae의 lactic acid 생산수율 향상을 위한 조건 탐색
장병관 ; 정덕열 ; 설정만 ; 이유경 ; 김수린*
경북대학교 식품공학부

Xylose Facilitates Lactic Acid Yield of Engineered Saccharomyces cerevisiae
Byeong-Kwan Jang ; Deokyeol Jeong ; Jeongman Seol ; You-Kyung Lee ; Soo Rin Kim*
School of Food Science and Biotechnology, Kyungpook National University, Daegu 41566, Korea
Correspondence to : *School of Food Science and Biotechnology, Kyungpook National University, Daegu 41566, Korea Tel: +82-53-950-7769, Fax: +82-53-950-7762 E-mail: soorinkim@knu.ac.kr


© 2020 The Korean Society for Biotechnology and Bioengineering

Abstract

Lactic acid is widely used in the food, pharmaceutical, textile and chemical industries. Also, poly-lactic acid (PLA) is in increasing demand as an environmentally friendly and biodegradable plastic. In our prior study, a lactic acid-producing, xylose-fermenting Saccharomyces cerevisiae strain (SR8 LDH) has been developed. In the present study, we tested the SR8 LDH strain under various fermentation conditions to discover the most important condition determining lactic acid and ethanol production profiles. Using xylose as a substrate significantly improved lactic acid yields compared to using glucose under microaerobic conditions. High initial cell density improved lactic acid productivity, but it did not affect ethanol production. Lastly, when fermenting xylose, the PDC1 gene encoding pyruvate decarboxylase was transcriptionally repressed, which might be associated with the production of low ethanol and high lactic acid. These results indicate that the type of a carbon source, i.e. using xylose instead of glucose could be a promising solution for lactic acid production by engineered S. cerevisiae.


Keywords: fermentable sugar, metabolites, transcriptome analysis, CRISPR-Cas9, yeast

1. INTRODUCTION

Lactic acid는 예전부터 식품 및 섬유, 화학, 약학 등 다양한 산업에서 사용되는 유기 물질이다. 최근 미세 플라스틱과 관련된 환경 오염 문제가 대두됨에 따라서 생분해 가능한 플라스틱에 대한 관심이 커지고 있다 [1,2]. 생분해가 가능한 바이오 플라스틱 중 하나인 poly lactic acid (PLA)는 lactic acid의 중합체로, 3D 프린터의 활용과 함께 앞으로의 부가가치가 높게 평가되는 소재중 하나이다 [3,4]. PLA의 단위체인 lactic acid는 화학적 반응 혹은 미생물의 발효를 이용한 생물학적 방법을 통해 생산할 수 있지만 [5,6], 최근에는 대부분의 lactic acid를 lactic acid bacteria (LAB)의 발효를 통해서 생산하고 있다 [6]. 하지만 LAB을 이용한 lactic acid 생산의 경우, 발효가 진행됨에 따라 배양액 내부에 조성되는 스트레스에 의하여 lactic acid의 생산량, 순도 등이 감소하는 문제가 제기된 바 있다 [7].

이러한 문제를 해결하기 위해 기존 연구에서는 LAB보다 산 내성이 높으며 GRAS (Generally recognized as safe) 균주로 알려진 Saccharomyces cerevisiae 효모가 glucose를 기질로 이용하여 lactic acid를 생산할 수 있도록 pyruvate를 lactate로 전환시키는 lactate dehydrogenase 유전자(LDH)를 도입하는 대사 공학 기법이 이용되었다 [8-11]. 나아가 효모가 glucose 뿐만 아니라 xylose와 같은 대체 기질을 이용하여 lactic acid를 생산하는 추가적인 연구가 진행되었다 [12,13]. Xylose는 목질계 바이오매스 가수분해물에서 glucose 다음으로 많은 비율을 차지하고 있으며 [14] 사탕수수 및 옥수수 줄기, 곡물류의 짚단을 비롯한 농업 부산물의 전처리를 통해서 쉽게 얻을 수 있어 앞으로의 활용가치가 높다 [15]. 본 연구에서는 S. cerevisiae 균주가 원래 이용하지 못하는 xylose를 대사 할 수 있으며, 동시에 LDH 유전자 도입을 통해 lactic acid를 생산할 수 있는 균주인 S. cerevisiae SR8 LDH 균주 [7]를 이용하여 여러가지 발효 조건에서의 lactic acid 생산 능력을 비교하고자 한다.

이를 확인하기 위해 기질 및 산소, 초기 세포 농도 조건 등 다양한 조건에서의 발효를 통해 그 표현형들을 분석하고 RT-qPCR 분석을 통하여 lactic acid 및 ethanol 생산에 관여하는 유전자의 발현량을 비교하여 균주의 발효 특성 및 발효 조건에 대한 최적조건과 유전자 발현특성의 차이를 탐색하였다. 본 연구를 통하여 추후 lactic acid를 생산하는 새로운 균주의 개발과 효모를 이용한 lactic acid의 산업적 생산에 도움을 줄 수 있는 기반을 다지고자 한다.


2. MATERIALS AND METHODS
2.1. 균주

본 연구에서 사용한 SR8 LDH 균주는 이전 연구 [7]에서 개발되었다. 요약하자면, xylose를 소모할 수 있도록 개발된 S. cerevisiae SR8 균주 [16]Lactobacillus acidophilus ATCC4356 유래 LaLDH 유전자 (L-lactate dehydrogenase)의 발현 카세트 (PGK1p-LDH-CYC1t)를 CRISPR-Cas9 유전자 가위 기술로 genome integration 시켜 SR8 LDH 균주를 개발하였다.

2.2. 배지 및 발효

발효는 균주로부터 하나의 군락을 취해 20 g/L glucose 및 50 mM potassium hydrogen phthalate 가 포함된 YP (10 g/L yeast extract, 20 g/L peptone) 액체 배지에 30oC, 250 rpm 조건에서 24시간 동안 전배양을 실시하였다. 전배양한 균주를 초기 세포 농도 0.05, 0.5, 5, 25 g DCW/L (g dry cell weigh/L)로 세포만 회수하여 100-mL Erlenmeyer flask에 접종하였으며, 초기 세포 농도 25 g DCW/L의 경우 50-mL Erlenmeyer flask에 접종하였다. 각각의 발효는 40 g/L glucose (YPD) 또는 40 g/L xylose (YPX) 가 포함된 20 mL YP 액체 배지에 접종 후 30oC 및 다양한 산소 조건 (80 rpm, 250 rpm)에서 진행하였다. 초기 세포 농도 25 g DCW/L 발효의 경우, 동일한 조성의 10 mL YPD 또는 YPX 액체배지에서 발효하였다. 이때, 80 rpm 및 30oC 조건으로 발효하게 되면 배양액 내부에 존재하는 고농도의 cell이 배양액 내부에서 가라앉는 것을 확인하였다. 이러한 침전을 막고 배양액 내부 조성의 균일화를 위하여 80 rpm보다 상향조절한 130 rpm 조건으로 발효하였다. 혐기 발효의 경우 동일한 조성의 10 mL YPD 또는 YPX 액체배지에 2 mg/L resazurin을 첨가한 후 125-mL serum bottle에 30oC 및 130 rpm 조건으로 발효를 진행하였으며, 모든 발효는 3반복으로 시행되었다.

2.3. 발효 표현형 분석

발효 중 배양액의 세포 흡광도는 600 nm 파장에서 분광광도계 (OPTIZEN NANO, Mecasis, Korea)를 이용하여 측정한 후 이를 건조중량으로 환산하였다 (OD600 1 = 0.47 g DCW/L). 배양액 내의 glucose 및 xylose, ethanol, lactic acid의 농도는 기존 연구[17]와 동일한 방법을 이용하여 분석하였다. 배양액을 10배 또는 100배 희석하여 13000 rpm에서 10분 동안 원심분리를 거친 후, 상등액만 취하여 RI detector를 이용한 고성능 액체 크로마토그래피 (HPLC, Agilent Technologies, 1260 Series, USA) 기기를 이용하여 분석하였다. 이때 Column은 Rezex ROA-Organic Acid H+ (8%) (Phenomenex Inc., Torrance, CA)을 사용하였고, 이동상은 0.005 N H2SO4을 이용하여 50oC에서 0.6 mL/min의 속도로 용출 시켰다. Glucose 및 xylose, ethanol, lactic acid의 retention time은 각각 4.938, 5.342, 10.873, 6.960 min이다.

2.4. RT-qPCR 분석

LaLDHPDC1 유전자의 RT-qPCR 분석은 기존 연구에서 많은 부분을 차용하였다 [18]. 실험에 사용된 cDNA는 20 g/L glucose 및 40 g/L xylose 기질 조건에서 자란 세포로부터 추출한 RNA를 이용하여 제작하였다. cDNA 및 primer (Table 1), iQ™ SYBR Green Supermix (Bio-Rad, Hercules, CA, USA)를 이용하여 qPCR를 진행하였으며, CFX Connect™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) 기기를 이용하였다. 사용된 primer의 경우 LaLDHPDC1 유전자의 발현량 분석을 위해 새롭게 디자인하였다.

Table 1. 
Primers used in this study
Gene Name Sequence (5’-)
For RT-qPCR analysis
LaLDH kim432 AAGGTTAGCGACTGGGTTAAG
kim433 GCTGTACCGATACCGTAGAAAG
PDC1 kim504 CCCAAGATACGGTGGTGTTT
kim505 TTAGCGGCGTCAGCAATAG
ACT1 kim102 GCCTTCTACGTTTCCATCCA
kim103 GGCCAAATCGATTCTCAAAA


3. RESULTS AND DISCUSSION
3.1. 산소 및 기질 조건에 따른 발효 표현형 비교

SR8 LDH 균주의 발효에서 기질 및 산소 조건이 lactic acid와 ethanol의 생산량에 어떤 영향을 미치는지 알아보기 위하여, 40 g/L glucose 혹은 40 g/L xylose를 포함한 YP 배지에서 초기 세포 농도를 0.05 g DCW/L로 설정하여 미세 호기 조건 (80 rpm) 및 호기조건 (250 rpm)에서 각각 발효를 시행하였다 (Fig. 1).


Fig. 1. 
Fermentation profiles of the SR8 LDH strain in YP medium containing 40 g/L glucose (a, c) or 40 g/L xylose (b, d) under oxygen limited (80 rpm; a, b) or aerobic (250 rpm; c, d) conditions with initial cell concentration of 0.05 g DCW/L (g dry cell weight/L). Lactic acid yields (e) and ethanol yields (f) were calculated at the maximum production of lactic acid as indicated with arrows (a-d). The values are the mean of three independent experiments, and the error bars indicate the standard deviations.

미세 호기 조건에서 glucose를 기질로 발효할 경우 23시간 동안 40 g/L의 glucose를 모두 소모하여 lactic acid와 ethanol을 21.4 g/L 및 12 g/L 만큼 생산하였으며, xylose는 120시간 동안 35 g/L 만큼 소모하여 lactic acid와 ethanol을 각각 38.9 g/L 및 1.2 g/L 만큼 생산하였다. SR8 LDH 균주는 미세호기 조건에서 glucose를 소모할 때보다 xylose를 소모할 때 81.7% 더 증가한 양의 lactic acid를 생산하였다. 하지만 ethanol은 glucose 기질을 소모할 때보다 xylose를 소모할 때 생산량이 10분의 1로 감소하였다. 또한 lactic acid의 생산수율은 각각의 기질을 이용할 때 0.53 g/g glucose 및 1.19 g/g xylose로, SR8 LDH 균주는 xylose를 이용할 때 2배 이상의 lactic acid 생산수율을 보여주었다. 호기 조건에서는 23시간 동안 39.6 g/L의 glucose를 소모하였으며, 13.2 g/L의 lactic acid를 축적하였다. 또한 xylose는 48시간 동안 31 g/L 만큼 소모하면서 17.9 g/L의 lactic acid를 축적하여, 미세 호기 조건과 마찬가지로 xylose를 소모할 때 lactic acid의 생산량이 더 증가하는 것을 확인할 수 있었다. 호기 조건에서의 lactic acid 생산수율의 경우 glucose 와 xylose를 이용할 때 각각 0.33 g/g glucose 및 0.57 g/g xylose로, glucose 조건보다 72% 증가한 것을 확인하였다. Ethanol 생산수율은 산소 조건에 상관없이 glucose를 이용할 때 약 0.3 g/g glucose 이였으며, xylose를 소모할 경우에는 미세 호기, 호기 조건에서 0.016, 0.08 g/g xylose로 산소 조건별로 차이를 보였으나 같은 조건에서의 glucose 기질 조건과 비교하였을 때 크게 감소한 것을 확인할 수 있었다.

본 실험을 통해서, glucose 보다 xylose를 대사 하는 것이 lactic acid의 생산량과 생산수율이 더 증가한 반면, ethanol 생산은 억제되어 lactic acid 생산에 더욱 유리한 것을 확인할 수 있었다. 또한 호기 조건보다 미세 호기 조건이 더 lactic acid 생산에 있어서 유리했고, 미세 호기 조건에서 xylose를 발효할 때 lactic acid 생산수율이 가장 높았다.

3.2. 혐기 조건에서 lactic acid 및 ethanol 생산

앞선 실험에서, SR8 LDH 균주는 xylose 기질을 이용하는 것이 glucose 기질을 이용할 때 보다 lactic acid 생산에 더 유리하며, 호기조건보다 미세 호기조건에서 더 많은 양의 lactic acid를 생산하는 것을 확인하였다. 우리는 이러한 결과를 바탕으로 SR8 LDH 균주가 혐기 조건에서 xylose를 소모할 때 더 많은 양의 lactic acid를 생산할 수 있는지 확인하고자 했다. 이때 혐기 조건에서의 세포 성장이 억제되는 것을 감안하여 초기 세포 농도를 5 g DCW/L로 설정하여 발효를 진행하였으며, 발효 중 세포의 침전을 방지하기 위하여 교반 속도는 130 rpm으로 상향조절 하였다. 그 결과, SR8 LDH 균주는 36시간 동안 40 g/L의 glucose를 소모하여 27.4 g/L의 lactic acid와 14.1 g/L의 ethanol을 축적하였다 (Fig. 2(a)). 하지만 xylose의 경우 발효 초기 5시간 동안 약 5 g/L의 기질만 소모하여 lactic acid는 4.1 g/L, ethanol은 1.5 g/L 생산하면서 xylose를 거의 소모하지 못하는 표현형을 보여주었다 (Fig. 2(b)).


Fig. 2. 
Fermentation profiles of the SR8 LDH strain in YP medium containing 40 g/L glucose (a) or 40 g/L xylose (b) with 2 mg/L resazurin under anaerobic condition with initial cell concentration of 5 g DCW/L (g dry cell weigh/L). The values are the mean of three independent experiments, and the error bars indicate the standard deviations. Lactic acid and ethanol yields (c) were calculated at the maximum production of lactic acid as indicated with arrows (a-b). The values are the mean of three independent experiments, and the error bars indicate the standard deviations.

Lactic acid 생산수율의 경우, glucose 및 xylose 기질을 소모할 때 각각 0.68, 1.59 g lactic acid/g substrate로 xylose 기질을 소모하는 것이 glucose 기질을 소모할 때 보다 58% 증가한 것을 확인하였다. Ethanol 생산수율은 glucose와 xylose 각각의 기질을 소모할 때 각각 0.35, 0.32 g ethanol/g substrate로 두 기질 간의 큰 차이를 보이지 않았다 (Fig. 2(c)). 따라서 혐기 조건에서는 SR8 LDH 균주의 xylose 소모가 현저히 늦어지는 것을 확인할 수 있었으며, 이는 기존 연구와 비슷한 경향을 보였다 [19,20]. 또한 SR8 LDH 균주는 산소가 적은 조건일수록 xylose를 소모할 때 lactic acid 생산에 유리하지만, 완전 혐기 조건에서는 xylose를 소모하지 못하는 모습을 보였다. 반면 glucose 기질의 경우 xylose 기질 조건과는 달리 균주가 기질을 모두 소모하여 lactic acid를 상당량 생산하는 것을 확인하였다. 따라서 본 실험을 통해 SR8 LDH 균주가 xylose를 소모할 때 일정량의 산소를 꼭 필요로 한다는 가설을 세울 수 있으며. 이에 대해서는 추후 추가적인 연구가 필요할 것으로 사료된다.

3.3. 초기 세포 농도에 따른 lactic acid 및 ethanol 생산

Lactic acid 생산효율을 향상시키는 방법으로 xylose를 기질로 사용하는 것과 미세 호기조건에서 발효하는 것이 유리함을 알았다. 다음으로는 초기 세포 농도를 증가시킴으로써 lactic acid의 생산성을 향상시킬 수 있을지 확인하고자 하였다. 초기 세포 농도를 0.05, 0.5, 5, 25 g DCW/L로 달리하여 xylose 발효를 수행하였고, 그 결과를 lactic acid와 ethanol의 specific productivity (g/g DCW/h)로 정리하였다 (Fig. 3). 이 때, ethanol 생산성은 초기 세포 농도에 크게 영향을 받지 않았으나, lactic acid의 생산성은 초기 세포 농도가 증가함에 따라 향상됨을 알 수 있었다. 세포 농도가 증가함에 따라 세포가 이용할 수 있는 산소의 양은 줄어들기 때문에 [21], 산소가 적은 조건에서 xylose 기질을 소모하는 것이 lactic acid 생산에 유리하다는 것을 다시 한 번 확인하였다.


Fig. 3. 
Specific metabolites productivity of the SR8 LDH strain fermented in various conditions. The fermentation performed in YP medium containing 40 g/L xylose under oxygen limited condition (80 rpm) with initial cell concentration of 0.05, 0.5, 5 and 25 g DCW/L (g dry cell weigh/L). The regressions were significant at 0.05 level. The values are the mean of three independent experiments, and the error bars indicate the standard deviations.

3.4. 기질의 종류에 따른 유전자 발현특성

앞선 실험에서, glucose 보다 xylose를 대사 할 때 lactic acid의 생산량이 늘며, ethanol의 생산이 줄어드는 것을 확인하였다 (Fig. 1). 또한 기존 연구에서는 효모 균주가 이용하는 기질에 따라서 외래 유전자를 포함한 전사 단계에서의 차이가 생긴다고 보고한 바 있다 [22]. 따라서 SR8 LDH 균주 역시 기질에 따라서 전사 단계에서의 차이가 생겼으며, 이러한 차이로 인하여 lactic acid와 ethanol의 생산 양상이 달라진다는 가설을 세웠다. 이를 확인하고자 lactic acid와 ethanol 생산에 관여하는 LaLDHPDC1 두 유전자에 대한 RT-qPCR 분석을 시행하였으며, 기질에 따른 두 유전자의 발현량의 차이를 비교하였다 (Fig. 4).


Fig. 4. 
Relative expression level of LaLDH and PCD1 normalized to ACT1 of the SR8 LDH strain on glucose and xylose fermentations. All cells were growth in YP medium containing 20 g/L glucose or 40 g/L xylose under oxygen limited condition (80 rpm) with initial cell concentration 0.05 g DCW/L (g dry cell weigh/L). The values are the mean of three independent experiments, and the error bars indicate the standard deviations.

그 결과, SR8 LDH 균주에서 ethanol 생산에 가장 주요하게 관여하는 PDC1 유전자의 발현량이 glucose 조건 대비 xylose 조건에서 절반 이하로 감소한 것을 확인할 수 있었다. 또한, lactic acid 생산에 관여하는 LaLDH 유전자의 발현이 glucose 조건 대비 xylose 조건에서 약간 증가하였다. 이러한 결과는, xylose를 기질로 사용함으로써 ethanol 생산과 관련된 유전자의 발현이 억제될 수 있으며, 이러한 조건이 lactic acid 생산에 유리하게 작용할 수 있음을 시사한다.


4. CONCLUSION

본 연구에서는 L. acidophilus로부터 유래한 LaLDH 유전자를 도입한 S. cerevisiae 균주가 기질에 따라서 어떠한 발효 특성을 보이는지 확인하고, 어느 조건에서 lactic acid를 생산하는 것이 더 유리한지 확인하고자 하였다. 이를 위해서 xylose를 대사 할 수 있으며, lactic acid를 생산하는 S. cerevisiae SR8 LDH 균주를 기질 종류, 산소 조건, 초기 세포 농도 등을 달리하면서 발효를 시행하였다. 실험을 통하여 SR8 LDH 균주는 xylose를 대사 할 때 미세 호기 조건 (80 rpm)에서 lactic acid의 생산수율이 최대화되고 동시에 ethanol의 생산이 감소되는 것을 확인하였다. 또한 xylose를 대사 할 때 혐기 조건에서는 오히려 xylose 발효가 억제되어 lactic acid 생산효율이 낮지만, 초기 세포 농도를 높임으로써 이용가능한 산소의 양을 줄이는 것은 lactic acid 생산성 향상에 도움이 되는 것을 확인하였다. 마지막으로 xylose를 대사할 경우 ethanol 생산관련 유전자의 발현량이 유의적으로 감소하였고, 이는 lactic acid의 생산량이 증가하고 ethanol의 생산량은 감소하는 원인 중 하나일 것이라고 판단되었다.


REFERENCES
1. Esteban, J., M. Ladero (2018) Food waste as a source of valueadded chemicals and materials: a biorefinery perspective. Int. J. Food Sci. Technol. 53: 1095-1108.
2. Bustamante, D., M. Tortajada, D. Ramón, A. Rojas (2020) Production of D-Lactic Acid by the Fermentation of Orange Peel Waste Hydrolysate by Lactic Acid Bacteria. Fermentation. 6: 1.
3. Jamshidian, M., E. A. Tehrany, M. Imran, M. Jacquot, S. Desobry (2010) Poly-Lactic Acid: production, applications, nanocomposites, and release studies. Compr. Rev. Food. Sci. Food Saf. 9: 552-571.
4. Singhvi, M., S. Zinjarde, D. Gokhale (2019) Poly-Lactic acid (PLA): synthesis and biomedical applications. J. Appl. Microbiol. 127: 1612-1626.
5. Sauer, M., D. Porro, D. Mattanovich, P. Branduardi (2008) Microbial production of organic acids: expanding the markets. Trends Biotechnol. 26: 100-108.
6. Ghaffar, T., M. Irshad, Z. Anwar, T. Aqil, Z. Zulifqar, et al. (2014) Recent trends in lactic acid biotechnology: a brief review on production to purification. J. Radiat. Res. Appl. Sci. 7: 222-229.
7. Kim, J.-w., J. H. Jang, H. J. Yeo, J. Seol, S. R. Kim, et al. (2019) Lactic Acid Production from a Whole Slurry of Acid-Pretreated Spent Coffee Grounds by Engineered Saccharomyces cerevisiae. Appl. Biochem. Biotechnol. 189: 206-216.
8. Skory, C. D. (2003) Lactic acid production by Saccharomyces cerevisiae expressing a Rhizopus oryzae lactate dehydrogenase gene. J. Ind. Microbiol. Biotechnol. 30: 22-27.
9. Baek, S.-H., E. Y. Kwon, Y. H. Kim, J.-S. Hahn (2016) Metabolic engineering and adaptive evolution for efficient production of Dlactic acid in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 100: 2737-2748.
10. Ishida, N., T. Suzuki, K. Tokuhiro, E. Nagamori, T. Onishi, et al. (2006) D-Lactic acid production by metabolically engineered Saccharomyces cerevisiae. J. Biosci. Bioeng. 101: 172-177.
11. Ryu, A. J., T. Y. Kim, D. S. Yang, J. H. Park, K. J. Jeong (2018) Engineering of Saccharomyces cerevisiae for enhanced production of L-lactic acid by co-expression of acid-stable glycolytic enzymes from Picrophilus torridus. Korean J. Chem. Eng. 35: 1673-1679.
12. Turner, T. L., G.-C. Zhang, S. R. Kim, V. Subramaniam, D. Steffen, et al. (2015) Lactic acid production from xylose by engineered Saccharomyces cerevisiae without PDC or ADH deletion. Appl. Microbiol. Biotechnol. 99: 8023-8033.
13. Turner, T. L., G. C. Zhang, E. J. Oh, V. Subramaniam, A. Adiputra, et al. (2016) Lactic acid production from cellobiose and xylose by engineered Saccharomyces cerevisiae. Biotechnol. Bioeng. 113: 1075-1083.
14. Qi, Q., Q. Liang (2015) Chapter 9 - Single-Cell Biorefinery. pp.369-388. In: Pandey, A., R. Höfer, M. Taherzadeh, K. M. Nampoothiri, C. Larroche (eds.). Industrial Biorefineries & White Biotechnology. Elsevier, Amsterdam.
15. Lin, C.-Y., C.-H. Cheng (2006) Fermentative hydrogen production from xylose using anaerobic mixed microflora. Int. J. Hydrog. Energy. 31: 832-840.
16. Kim, S. R., J. M. Skerker, W. Kang, A. Lesmana, N. Wei, et al. (2013) Rational and Evolutionary Engineering Approaches Uncover a Small Set of Genetic Changes Efficient for Rapid Xylose Fermentation in Saccharomyces cerevisiae. PLoS One. 8: e57048.
17. Shin, M., J.-w. Kim, S. Ye, S. Kim, D. Jeong, et al. (2019) Comparative global metabolite profiling of xylose-fermenting Saccharomyces cerevisiae SR8 and Scheffersomyces stipitis. Appl. Microbiol. Biotechnol. 103: 5435-5446.
18. Kim, S. R., H. Xu, A. Lesmana, U. Kuzmanovic, M. Au, et al. (2015) Deletion of PHO13, Encoding Haloacid Dehalogenase Type IIA Phosphatase, Results in Upregulation of the Pentose Phosphate Pathway in Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 81: 1601-1609.
19. van Hoek, P., E. de Hulster, J. P. van Dijken, J. T. Pronk (2000) Fermentative capacity in high-cell-density fed-batch cultures of baker's yeast. BIOTECHNOL. BIOENG. 68: 517-523.
20. Novy, V., B. Brunner, B. Nidetzky (2018) l-Lactic acid production from glucose and xylose with engineered strains of Saccharomyces cerevisiae: aeration and carbon source influence yields and productivities. Microb. Cell. Fact. 17: 59.
21. Verbelen, P., S. Saerens, S. Van Mulders, F. Delvaux, F. Delvaux (2009) The role of oxygen in yeast metabolism during high cell density brewery fermentations. Appl. Microbiol. Biotechnol. 82: 1143-1156.
22. Yun, E. J., E. J. Oh, J.-J. Liu, S. Yu, D. H. Kim, et al. (2018) Promiscuous activities of heterologous enzymes lead to unintended metabolic rerouting in Saccharomyces cerevisiae engineered to assimilate various sugars from renewable biomass. Biotechnol. Biofuels. 11: 140.